Generalizirani mravlje

To je nekaj dodatnega gradiva za papir Nadaljnje potovanje z mojim Antom David Gale, Jim Propp, Scott Sutherland in Serge Troubetzkoy, ki se pojavlja v poletni izdaji Matematičnega inteligencera leta 1995. V tem članku je obravnavano nekaj obnašanja celičnega avtomatskega sistema, imenovanega “ant”. Mravlja se premika okoli in v vsaki “celici” mravlja zavije desno ali levo, odvisno od stanja celice, nato pa spremeni stanje celice v skladu z določenimi predpisanimi pravili niza.

 

 

 

Na kratko, “mravljinec” se premika na neskončni kontrolni plošči, pri čemer je vsak kvadrat označen kot “celica”. Vsaka celica v ravnini je označena kot L-celica ali R-celica (ponavadi ena zapolni ravnino z L-celicami za začetek). Ant se začne na meji med dvema celicama in ko prehaja skozi vsako celico, naredi 90 stopinjski zavoj, obrnjen na levo v celicah L in na desni v R-celicah, in spremeni stanje celica je pravkar zapustila, preklopi L-celice v R-celice in obratno. Po tem preprostem nizu pravil povzroča nekaj precej zapletenega vedenja; vzorec mrtve steze se spreminja med navideznim kaosom in simetrijo in sčasoma začne graditi avtocesto, ki se premika v eni smeri.

Zgoraj opisani ant (in nekatere različice) je prvotno preučil Chris Langton (nato v Inštitutu Santa Fe, nedavno soustanovitelj Swarm Corporation). Kasneje je Jim Propp posplošil mravljinčino tako, da je vsaka celica v enem od n različnih stanj: vsaka mravlja ima nekaj “notranjega programiranja”, ki pove, ali naj zavije levo ali desno, ko je celica v tem stanju. Ta “program” je lahko predstavljen kot niz n Ls in Rs, in kth črka predstavlja mrtvo dejanje, ko gre za celico v stanju k. Na primer, Langtonov mrav, opisan zgoraj, je 2 mravljinčastega mravlja s pravilnim nizom LR (ali v binarnem 10, zato imenujemo to “ant številko 2”). 7 državni mravlja s pravilnim nizom LLRRRLR (mravljična številka 98) zavije v levo, ko obišče celico v stanju 1, 2 ali 6 in pravico, ko obišče celice v stanju 3, 4, 5 ali 7.

Za vse takšne generalizirane mravlje je mogoče zlahka opaziti, da če je v pravilnem nizu vsaj en L in vsaj en R, bo sled mravljin vedno neomejen. Nekateri mravi imajo ponavljajočo se simetrijo, drugi pa očitno kaotično vedenje.


Slike nekaterih držav mravelj.
Lahko dobite nekaj a voden ogled, dobite celotno serijo v zip arhiv, ali izberite datoteke ena v trenutku.

Oglejte si spodaj navedene simulatorje Java, ki jih lahko zaženete v brskalnikih, ki omogočajo Java. Steve Witham je zbral nekaj več povezave do programske opreme in izdelkov.


Nekatere izvorne kode za ant simulatorja, ki bo vodila različne vrste računalniških sistemov.

* Simulator, ki temelji na psov, ki dodaja Truchet-ploščice izpis v Jim Proppova različica.
Izvorne datoteke za ant.c lahko dobite v zip arhivu ali pa prenesete datoteke eno v trenutku.

* Vmesnik, ki temelji na X11, s pomočjo knjižnice Athena widget. (trenutno ne proizvaja izpisa za tiskanje).
Izvorne datoteke za Xant lahko dobite v zip arhivu ali naložite datoteke v eni v trenutku,

* Javna različica Langtonove mravlje, (pravilo št. 2) Steve Witham,

* Drug Java različica Langtonovega Antja (pravilo 2), ki ga je pripravil Bill Casselman z Univerze v Britanski Kolumbiji.

* Simulator za Microsoft Windows, ki ga je napisal Edward Richards. Omogoča bolj splošen nabor gibov mravlje (več mravlje, naprej in nazaj, kot tudi desno in levo, itd.), Zato so številčna kodiranja njegovih pravnih lastnosti drugačne od tistih, ki so tukaj obravnavane. Zelo lep program.

* Simulator Langtonovega 2-državnega mravlja (Ant 2), ki deluje na grafičnem računalniku TI-82 (ki ga je napisal Adam Beytin, c / o mbeytin@umd5.umd.edu). Nisem imel TI-82, tega programa nisem zagnala.


Za več podrobnosti glejte

  • D. Gale “Industrious Ant”, Mathematical Intelligencer, vol. 15, št. 2 (1993), str. 54-58.
  • D. Gale in J. Propp “Nadaljnje antike”, Mathematical Intelligencer, vol. 16, št. 1 (1994), str. 37-42.
  • D. Gale, J. Propp, S. Sutherland, S. Troubetzkoy, “Nadaljnja potovanja z mojim Antom”, Mathematical Intelligencer, vol. 17, št. 3 (1995), str. 48-56.
  • I. Peterson, “Potovanja mravlje”, Science News, vol 148 št. 18 (1995), str. 280-281.
  • L.A. Bunimovich in S. Troubetzkoy “Ponovitvene lastnosti Lorentzove rešetke s celičnim avtomatom”, Journal of Statistical Physics, vol. 67 (1992), str. 289-302.
  • Dodatne reference, ki jih vodi Serge Troubetzkoy.

 

by : audioreputation.com

Linearna algebra in uporaba učbenikov


Pozdravljeni. Da bi perspektivnim uporabnikom omogočili preprosto in priročno predogled mojega besedila, sem v preteklosti dal kopijo tega v spletu za vaše preučevanje. V zadnjih nekaj letih sem prejel številne pripombe in pohvale za to, da sem to storil. Rad bi se zahvalil tistim, ki ste mi poslali te pripombe in pripombe. Pomagali ste mi bistveno izboljšati besedilo. Zdaj sem s pogodbo z Springer-Verlagom in knjiga je bila objavljena v nizu dodiplomskih besedil v matematiki v težkih in, nazadnje, mehkih naslovnicah. Zato sem odstranil spletno kopijo. Spodnji kazalček bom zapustil za informativne namene, skupaj z napakami za vsako različico učbenika. Nekaj komentarjev:

Zakaj to besedilo? Zavezan sem k uravnoteženi mešanici teorije, uporabe in računanja. Matematiki začenjajo videti svojo disciplino bolj kot eksperimentalno znanost, računalniška programska oprema pa kot “laboratorij” za matematično eksperimentiranje. Verjamem, da mora poučevanje linearne algebre vključiti to novo perspektivo. Moje lastne izkušnje segajo od čistega matematika (moja prva raziskava je bila v skupini in teoriji obroča) numeričnemu analitiku (moja trenutna posebnost). Videl sem linearno algebro iz številnih pogledov in mislim, da imajo vsi ponuditi nekaj. Moje računalniške izkušnje delajo kot uporaba tehnologije v tečaju – naravna primernost za linearno algebo – in računalniške vaje in skupinski projekti se prav tako dobro ujemajo v kontekst linearne algebre. Moja uporaba barv ozadja barve moja izbira in poudarek aplikacij in tem. Obenem imam tradicionalistično črko, ki pričakuje, da bo besedilo strogo, pravilno in popolno. Konec koncev, linearna algebra služi tudi kot mostni tečaj med nižjo in višjo matematiko.

Če imate kakršne koli predloge ali pripombe, mi spustite črto. Cenim povratne informacije.

Viri

Popoln rešitveni priročnik za vse vaje in težave v besedilu je na voljo inštruktorjem, ki so sprejeli besedilo. Inštruktorji, ki bi želeli kopijo tega priročnika, se morajo obrniti na Mark Spencer po elektronski pošti na naslov Mark.Spencer@springer.com.

V korist inštruktorjev in študentov, ki uporabljajo moje besedilo, na svoji spletni strani prenesem več prenesenih datotek, ki se posebej nanašajo na besedilo v njihove lastne imenike. Imam tudi popolne ključe za reševanje izpitov in projektov, ki jih najdem v imenikuh spodaj. Poslal bom te e-pošte inštruktorjem, ki na zahtevo uporabljajo moje besedilo. Besedilni materiali so na voljo v treh okusih: pdf za iskanje, lix in tex za spreminjanje in uporabo s strani inštruktorjev.

  • Maple Notebooks Vadnica prenosni računalniki v Mapleu, nekateri od njih so osnova za projekte linearne algebre.
  • Mathematica Notebooks Tutorial prenosniki v Mathematica, nekateri od njih so osnova za linearne algebre projektov (v starih mathematica. Mma in novih. Nb formatov. Jaz jih bom posodobiti v prihodnosti, ker nisem uporabljal Mathematica v nekaj časa. )
  • Datoteke Matlab Files za Matlab in program, podoben Matlabu, imenovanemu Octave, ki sem ga odkril zelo uporabno v linearni algebri.
  • Vzorec Dokumenti Tukaj so vzorčni učni načrti in izjave o politiki razreda, ki sem jih uporabil z mojim besedilom. Oblike so html, tex in lyx.
  • Primeri izpitov in projektov Tukaj so vzorčni izpiti, ki sem jih uporabil skupaj z mojim besedilom; so datoteke iz lateksa in lisa, zato jih lahko inštruktorji masirajo, da ustrezajo svojim potrebam.

Povratne liste

To je frustrirajuće, da debug besedilo, ki ste ga sami napisali. Ugotovil sem, da sem prevečkrat prebral, kar sem mislil, da bi bil na strani, ne pa kaj pravzaprav na strani. Želim se zahvaliti mojim številnim študentom in kolegom, ki so v besedilu sledili številnim napakam. Spoznala sem tudi, da se uredniška pomoč lahko najbolj nepričakovano obrne. Dolgo sem zahvalil dr. Davidu Taylorju in dr. Matsu Desaixu, ki so zelo dobro prebrali veliko besedila na lastno pobudo, in mi je prineslo veliko napak v mojo pozornost. Nekako sumim, da bitka ni končana, zato, če najdete kakršne koli napake, ki niso navedene spodaj, jih prijavite.

Napaka pri mehkem tiskanju besedila se nanaša tudi na trdi tisk, ki je prišel šest mesecev prej kot besedilo mehkega pokrova. Nasprotno pa je bila napaka pri trdem tisku izrezana pri tiskanju mehkega pokrova. Med pisanjem instrukcijskega priročnika za inštruktorja sem ponovil vse rešitve za vaje na zadnji strani besedila in ugotovil še nekaj več napak, ki so zabeležene spodaj v napakah

Here is the table of contents of the text:

Uporabljena analiza linearne algebre in matrike
z
Thomas S. Shores
Avtorske pravice © 2007 Springer Science + Business Media, LLC

Predgovor

Poglavje 1. LINEARNI SISTEMI EQUATIONS

 

1. Nekateri primeri

2. Oznake in pregled številk

3. Gaussova izločitev: osnovne ideje

4. Gaussova izločitev: splošni postopek

5. * Računalniške opombe in projekti

 

Poglavje 2. MATRIX ALGEBRA

 

1. Matrični dodatek in skalarno množenje

2. Matrično množenje

3. Uporaba matrike aritmetike

4. Posebne matrike in transponira

5. Matriks Inverses

6. Osnovne lastnosti determinant

7. * Računalniške opombe in projekti

 

Poglavje 3. VECTOR PROSTORI

 

1. Definicije in osnovni pojmi

2. Podprostori

3. Linearne kombinacije

4. Podprostori, povezani z matrikami in operatorji

5. Osnove in dimenzija

6. Ponovljeni linearni sistemi

7. * Računalniške opombe in projekti

 

Poglavje 4. GEOMETRIČNI ASPEKTI STANDARDNIH PROSTOROV

 

1. Standardni standard in notranji izdelek

2. Uporaba standardnih in notranjih izdelkov

3. Orthogonalne in enotne matrike

4. * Sprememba osnovnega in linearnega operaterja

5. * Računalniške opombe in projekti

 

Poglavje 5. PROBLEM EIGENVALUE

 

1. Definicije in osnovne lastnosti

2. Podobnost in diagonalizacija

3. Aplikacije za diskretne dinamične sisteme

4. Ortogonalna diagonalizacija

5. * Obrazec Schur in aplikacije

6. * Singularna razčlenitev vrednosti

7. * Računalniške opombe in projekti

 

Poglavje 6. GEOMETRIČNI VIDIKI IZVEDENIH PROSTOROV

 

1. Normirani prostori

2. Notranji proizvodni prostori

3. Algoritem Gram-Schmidt

4. Ponovno uvedeni linearni sistemi

5. * Operator Norms

6. * Računalniške opombe in projekti

 

Tabela simbolov

Odgovori na izbrane vaje

Reference

Indeks

 

Odvzet od : http://www.math.unl.edu/~tshores1/linalgtext.html

“PRVI DOPUST AYN RAND NA JAPONSKEM!”

Chris Matthew Sciabarra

Pravkar sem prejel kopije japonskega prevoda The Fountainhead, ki je bil objavljen 8. julija 2004. Pred nekaj leti me je obrnil Kayoko Fujimori iz Društvo za študij Ayn Randa na Japonskem. Kayo je tudi profesor na univerzi Momoyama Gakuin (vzdevek, univerza St. Andrew’s) v Osaki na Japonskem. Kayo me je vprašal, ali bom lahko razložil nekatere angleške idiomatske izraze, ki bi olajšali prevod v japonščino. Nimam pojma, če so bila moja pojasnila v pomoč (Kayo pravi, da so bili) in nimam pojma, kaj dejansko berem, ko odprem veličastno oddano 1000+ strani. Vendar vam lahko povem, da se je Kayo zelo potrudil v prevodu in da je končni izdelek videti čudovito, s kritično ilustracijo iz oljne slike, ki jo je ustvaril Nobuyuki Ohnishi, umetnik, znan po svojih delih v tej klasični obliki japonske animacije, anime . Ohnishi je znan tudi po risanju in barvanju nebotičnikov NYC po 11. septembru.

Kayo pojasnjuje, da na Japonskem nove knjige ureja širok “pas”. »Pas« ali »modri krilo« (glej zgoraj) reproducira majhen del knjige kot oglas. V tem primeru je Ayn Rand zapakirano za japonsko občinstvo z naslednjimi informacijami: “Ayn Rand je vodja libertarijanizma, filozofija ameriških ljudi, ki stoji proti neokonzervativnemu.” Prisežem, da nisem imel ničesar s tem; kot priznava Kayo, kopija ne zajema bistva Ayn Randa. Ampak jaz bi bil prvi, ki bi rekel, da je založnik pravilno ugotovil bistveno nasprotovanje med Randomom in neokonservativnimi misli. Očitno je, da mnogi japonski bralci zanima globalistične posledice neokonservatizma, tako da vse, kar predlaga, da je opozicija prodajna točka. Oglasi se nadaljujejo: “Ta roman je po anketi Random House in Modern Library leta 1998 postavil drugo med najboljših 100 (angleško pisanih) romanov 20. stoletja. Ta roman se je dobro prodajal že od leta 1943, več kot 7 milijonov kopije doslej! Prvi iztovor Ayn Randa na Japonskem! ”

Medtem je vidik tega projekta, ki mi je prižgal srce, priznanje Kayo na strani 1037 (priznanja so ponavadi objavljena na koncu knjig na Japonskem). Tukaj sem pregledal ustrezno stran:

Bil sem obveščen, da je moje ime, napisano v japonščini, levo od oklepajevega angleškega prevoda, 13 črk, vključno s 11-črkovnimi črkami in dvema obdobnima podobama, 4 vrstice na zgornji sliki. Kayo prevaja prelaz za mene:

Najprej se moram zahvaliti dr. Chrisu Matthew Sciabarri. Dr. Sciabarra je eden od najboljših in najbolj produktivnih znanstvenikov v študiji libertarijanstva in Ayn Rand. Njegove skrbne pripombe in premišljeni nasveti so mi pomagali dokončati moj težek projekt – prevod tega dolgega, velikega romana The Fountainhead. Velika predanost dr. Sciabarre prvemu srečanju med japonskimi intelektualci in Ayn Random ni mogoče preveč poudariti.

Hvala, Kayo, za vse vaše skrbnosti, vestnosti in prijaznosti.

Pridobite svojo kopijo japonske fontane z obiskom amazon.co.jp.

Other Essays by Chris Matthew Sciabarra Back to Dialectics & Liberty Home Page

 

Za izvirno angleško besedilo pojdite na: https://www.nyu.edu/projects/sciabarra/essays/japan.htm

Sistem za zaznavanje in raziskovanje mobilnih naprav (MOSES)

Anton Riedl

Meni

Pomembne povezave
Tiny OS namestitev
Programiranje zvezdic
Programiranje Mote
Linux programiranje

Člani

Roberto Flores
Costa Gerousis
Dave Hibler
Dr. Anton Riedl
Dali Wang

 

Pomembne povezave

Tiny OS Community Forum
Omrežje za senzorje samovzdevkov
Prenosi programske opreme Crossbowja

Tiny OS namestitev

Sledite tej strani za namestitev Tiny OS.

Namestitev na Ubuntu

Namestitveni postopek na strani Tiny OS daje samo rpm’s, ki so namenjeni Redhatovim sistemom (ali sistemom Redhat). Vendar je Ubuntu sistem, ki temelji na Debianu in zato zahteva pakete, specifične za Debian.
Kljub temu se lahko rpm še vedno uporablja. Sledite navodilom na strani namestitve Tiny OS. Pretvoriti morate rpm v pakete Debian. To je mogoče storiti s tujim ukazom:
sudo alien -d * .rpm

Pakete sem namestil z upraviteljem paketa Debian dpkg. Ukaz je nekaj takega:
dpkg -install whatever.deb
Prav tako bi bilo treba uporabiti ukaz apt-get install.

Programiranje zvezdic

Programi

Te programe lahko kopirate v zvezdico s scp ukazom. Mogoče bi jih bilo mogoče voditi tako, kot je to.
Izvorna koda za te programe se nahaja na moses pod /home/moses/tinyos-2.x/support/sdk/c.
Viri je treba navzkrižno sestaviti za procesorja ARM. Ročna orodja morajo biti nameščena na moses.

Uporaba programov

Serijski špediter sf

Serijski posrednik zagotavlja most med serijskim vmesnikom in omrežjem. Običajno se na zvezdnem vratu priključi serijska vrata na micaz mote. Mreža na drugi strani bi lahko bila povezava preko ethernet-a ali pa samo povezava na lokalnem gostitelju.
Uporaba: hitrost priklopa naprave sf
Primer: sf 9002 / dev / tts / 2 micaz

Serijski posrednik Pošlji sfsend

Ta program prikazuje, kako se paketi lahko pošiljajo preko serijskega posrednika.
Primer: sfsend IPADDRESS PORT 0x00 0xff 0xff 0x04 0x22 0x06 0x00 0x01 0x00 0xaa

To je surovi paket, ki mora slediti paketnim specifikacijam radijske povezave. Dane bajtne nastavitve morajo delovati kot primer za oddajni paket. To je en vidik, ki potrebuje nadaljnjo preiskavo. Sčasoma želimo poslati lastne podatke.

Programiranje Mote

Programi

Nalaganje programov

TinyOS modul je mogoče naložiti na mote bodisi prek programirne plošče USB ali preko zvezdnega vratca. Vendar, ko sem to naredil neposredno iz zvezdnega vratca, sem opazil, da postopek nalaganja blokira serijski vmesnik. Mote ni mogoče uporabiti takole. Verjetno (samo razmišljam o tem, vendar še nisem poskusil), bi lahko ponovno zagnali problem.
V vsakem primeru sta dva načina za prenos programa TinyOS na mote naslednja:

USB Programming Board v Linuxu

naredi micaz namestiti mib510, / dev / ttyUSB0

Linux programiranje

Programi

Naslednji programi tečejo le na napravi z rednim Linuxom. Naš cilj bi moral biti sprememba izvorne kode na način, ki se izvaja na zvezdnikih. Izvorno kodo lahko najdete na moses pod
/home/moses/tinyos-2.x/support/sdk/java

Java

Uporaba programov

Program Java Pošlji

Primer: java net.tinyos.tools.Send 00 ff ff 04 22 06 00 01 00 BB

Java program Poslušaj

Komunicirajte z mote skozi serijski vmesnik (in programsko ploščo USB) z uporabo storitve Listen:
java net.tinyos.tools.Listen -comm serijsko @ / dev / ttyUSB1: micaz

Kako poslušati serijski posrednik:
java net.tinyos.tools.Listen -comm sf @ IPADDRESS: 9002

 

Vir: http://www.pcs.cnu.edu/~riedl/research/moses/moses.html

 

Rutgersova univerza za fiziko in astronomijo

Rutgersova univerza za fiziko in astronomijo

Vanderbilt ultra-mehka psevdopotencialna spletna stran

To je primarno mesto za distribucijo generacijske kode “ UltraSoft PseudoPotential ” (USPP) iz skupine David Vanderbilt na univerzi Rutgers.

Kazalo

Brskanje in prenos paketa USPP

Če si želite ogledati ta paket in se seznaniti z njeno vsebino, si lahko ogledate najnovejšo različico v obliki DIRECTORY DREE.

Če želite uporabiti paket, ga morate prenesti kot je opisano spodaj.

Fortranovi viri za generiranje psevdopotencialov

Ta koda je prosto porazdeljena v skladu z javnimi licencami GNU GPL. Uporabite ga lahko za lastne raziskovalne namene ali ga posredujte drugim za podobno uporabo. Upoštevajte pa naslednje omejitve:

  • Koda ni zagotovljena brez napak.
  • Kakovost psevdopotencialov, ki jih ustvarjajo vhodne datoteke, ni zagotovljena.
  • Za ta paket ni zagotovljena aktivna podpora.

Viri Fortran v paketu USPP se začnejo z izdajo 7.3.3 (uspp-733). Prejšnje različice so bile razdeljene samo po e-poštni zahtevi; zadnji je bil “a7.3.2”. Kar zadeva vire Fortran, je uspp-733 v bistvu funkcionalno enakovreden a7.3.2 (le zelo majhne popravke in kozmetične izboljšave so bile narejene pri prehodu od 7,3,2 do uspp-733).

Glavne spremembe v odhodu od a.3.3.2 do uspp-733 so pomembna prenova strukture imenika, makefilov in dokumentacije ter dodajanje knjižnice prispevanih psevdopotencialov.

Oglejte si Source / README za povzetek izboljšav, ki so bile narejene izvornim kodam iz ene izdaje v drugo, vključno s tistimi, ki so vodile do najnovejšega uspp-736. Najbolj podrobne informacije o zgodovini izdaje najdete v komentarjih glave, ki sestavljajo prvih nekaj sto vrstic glavnega programa runatom.f.

Pretvorba v format PAW z uporabo USPP2PAW

Zahvaljujoč Marc Torrent in Francois Jollet je mogoče kodo USPP-ja dopolnjevati tako, da ustvarja potenciale PAW (povečanega projektorja), ki jih lahko beremo z ABINIT-om. Glej Kako zgraditi PAW atomske nabore podatkov za ABINIT z uporabo generatorja USPP za navodila in povezave za prenos. za navodila in povezave za prenos.

Pseudopotencialne knjižnice

Uporabnikom, ki iščejo knjižnico že ustvarjenih psevdopotencialov, je predlagano, da uporabijo Pseudopotencialna knjižnica Garrity-Bennett-Rabe-Vanderbilt (GBRV), ki so jo leta 2013 razvili Kevin F. Garrity, Joseph W. Bennett, Karin M. Rabe in David Vanderbilt , kot je opisano v “Pseudopotenciali za izračune DFT z visokim pretokom”, Comp. Mater. Sci. 81, 446 (2014) (lokalni pred tisk). Ta knjižnica je bila zasnovana in preizkušena za uporabo pri visokokakovostnih izračunih, ki zahtevajo natančno, izčrpno in računsko poceni knjižnico psevdopotencialov, testirana pa je bila v mnogih okoljih povezovanja.

Knjižnica je bila ustvarjena tako, da je bila 1) celovita, 2) robustno točna, in 3) računsko poceni. Knjižnico smo izdelali z enim samim nizkim ravninskim valovom in ga preizkusili s primerjavo vseh elektronskih izračunov za različne kovinske, ionske in kovalentno vezane materiale. Ugotovili smo, da GBRV knjižnica daje konstante mrež, bulk modulov in magnetne trenutke, ki imajo večjo splošno natančnost kot druge celovite knjižnice pseudopotencialov ter primerljive ali nižje računske stroške.

Čeprav so optimizirani za izračun visoke zmogljivosti, bi morale biti pseudopotenciali primerni za mnoge aplikacije.

Zgodovina knjižnice: Prej sem objavil “Legacy Library” psevdopotencialov, ki so bili sestavljeni sčasoma, večinoma so bili člani skupine Vanderbilt, večinoma konec devetdesetih in zgodnjih 2000-ih. Ta knjižnica je nepopolna, ad-hoc in ni dosledno testirana. Ne priporočam več teh navodil, ampak za združljivostjo za nazaj so podrobnosti še vedno objavljene tukaj.

Prenosi

Vsaka od spodnjih povezav kaže na tarredno-gzipiran arhiv distribucije, ki je naveden v obratnem kronološkem vrstnem redu. Prvi del imena (npr. “Uspp-736”) se nanaša na sprostitev izvornih virov v imeniku Bin /. Zadnja številka (npr. “-0”) se nanaša na zaporedje posodobitev za stvari, kot so knjižnica psevdopotencialov, dokumentacija ali makefile.

V večini Unix sistemov lahko arhivu razpakirate tako, da naredite nekaj podobnega

gunzip uspp-736-0.tgz
tar xf uspp-736-0.tar
rm uspp-736-0.tar

Začetek

Če želite samo generirati enega ali več pseudopotencialov, ki so že vključeni v knjižnico, morate najti večino informacij, ki jih potrebujete v AA-QUICK-START, kar pojasnjuje, kako sestaviti in zagnati program za generiranje pseudopotenciala iz datoteke parametrov knjižnice.

Če ste bolj ambiciozni in želite spremeniti obstoječega psevdopotenciala ali ustvariti povsem novega, glejte Doc / TUTORIAL.

Upoštevajte, da je privzeto pseudopotencial ustvarjen kot neformatirana binarna podatkovna datoteka, kot je opisano v dokumentu Doc / FORMAT. Če je potrebno, ga lahko pretvorite v formatirano obliko z uporabo utility programa reform.f v imeniku Utils.

Dokumentacija

Naslednje datoteke so lahko v pomoč pri usmerjanju:

  • AA-QUICK-START: Kratka navodila za pripravo in zagon programa za ustvarjanje potencialov v knjižnici.
  • Doc / TUTORIAL: Če želite ustvariti lasten lasten psevdopotencial, je to mesto za iskanje. Prav tako vam lahko pomaga oceniti kakovost obstoječega potenciala v knjižnici tako, da podate nekaj nasvetov o tem, kaj iskati v izhodni datoteki.
  • Doc / INPUT_AE: Opis strukture vhodne datoteke za predhodne vse-elektronske programe.
  • Doc / INPUT_GEN: Opis strukture vhodne datoteke za teče generacije psevdopotencialov.
  • Doc / FORMAT: Opis strukture izhodne datoteke in navodil za pretvorbo v formatirano obliko.
  • Utils / read_uspp.f: Vzorec programa, ki daje kratek povzetek pseudopotencialne strukture datotek.
  • Vir / runatom.f: To je glavni fortran program. V izvorni kodi je nekaj interne dokumentacije.

Reference literature o ultrasoftovih psevdopotencialih so predvsem te:

  • David Vanderbilt, “Mehki samozadostni pseudotoksični potenciali v generaliziranem formalizmu lastnih vrednosti”, “Phys. Rev. B 41 (Rapid Communications), 7892 (1990). (kopija revije, krajevna kopija)
  • Kari Laasonen, Roberto Car, Changyol Lee in David Vanderbilt, “Izvajanje ultra-mehkih pseudotoksinov v ab-initio molekularni dinamiki”, “Phys. Rev. B 43 (Rapid Communications), 6796 (1991). (kopija revije, krajevna kopija)
  • Kari Laasonen, Alfredo Pasquarello, Changyol Lee, Roberto Car in David Vanderbilt, “Molekularna dinamika Car-Parrinella z ultrazvočnimi pseudopotencijami Vanderbilt’s”, “Phys. Rev. B 47, 10142 (1993). (kopija revije, krajevna kopija)

Uporabniška skupnost

Zavedam se naslednjih kod odprtokodnih kod, ki lahko uporabljajo ultrasoftne pseudopotenciale, ki jih ustvari ta paket:

DACAPO je del projekta KAMP Open Software (CAMPOS) projekta Center za atomiko fizike materialov (CAMP) na Tehnični univerzi na Danskem. To je program skupne energije, ki temelji na teoriji funkcionalnosti gostote z uporabo ravninskega vala in Vanderbilt ultrasoft pseudopotencialov. Program izvaja samonastavne izračune za lokalno aproksimacijo gostote (LDA) in različne potenciale korelacijskih razmerij za izmenjavo splošnih gradientov (GGA). Lahko opravlja molekularno dinamiko in strukturne sprostitve in se lahko sestavi za seriel in vzporedno izvedbo na številnih strojnih ploščadih.

Distribucija DACAPO vsebuje a knjižnica ultrazvočnih psevdopotencialov ki pokriva večino periodične tabele, ustvarjene z uporabo starejše različice a7.0.0 tega paketa. Vendar se knjižnica DACAPO osredotoča na to, da se psevdopotencialom sami zagotovijo v binarni obliki, ne pa vhodne datoteke generacije. Slednje so zdaj na voljo za številne elemente v knjižnici DACAPO. Za več informacij glejte zgoraj.

PWSCF (samonastavljivo polje ploskih valov) je niz programov za izračun elektronskih struktur v okviru teorije funkcionalnosti gostote in teorije perturbacije funkcionalnosti gostote, pri čemer se uporablja osnovni valovni niz. Primarni avtorji so S. Baroni, S. de Gironcoli, A. Dal Corso in P. Giannozzi. Podpira več okusov standardnih ohranjevalnih pseudopotencialov in dveh okusov ultrazvočnih (glejte tukaj, “vdb” označuje združljivost s tem paketom, medtem ko je “RRKJ3” drugačen format). Medtem ko so prejšnje različice tega kodnega paketa vsebovale nekatere omejitve glede možnosti, ki bi se lahko uporabile pri ultrazvočnih potencialih, so te omejitve zdaj v veliki meri odpravljene, izjema pa je, da so izračuni derivatov tretjega reda še vedno nezdružljivi z ultrasoft potenciali.

JDFTx je funkcionalna koda gostote valovnih valov, ki uvaja funkcionalno teorijo skupne gostote [S.A. Petrosyan, A.A. Rigos in T.A. Arias, J Phys Chem B. 109, 15436 (2005)], ki zagotavlja posebno primeren okvir za izračun ab initio v elektrokemijskih kontekstih, npr. Elektronskih sistemov v stiku s tekočimi okolji.

Pretvorbene rutine so zdaj razvite za:

Abinit je bil revidiran, da bi lahko opisal opisane atome atomov (PAW), ki jih lahko grobo rečeno označimo kot “pseudopotenciale”. Modul z imenom “USpp2Abinit” omogoča izgradnjo potenciala PAW od začetnega ultrazvočnega pseudopotenciala, ki ga ustvarja kodo USPP. Ta funkcija bo imela Abinit različice 4.2.1 in novejše. Za več informacij glejte

Poleg tega so združljivi tudi naslednji lastniške pakete:

Koda CPMD je plavzoplastno izvajanje teorije funkcionalnosti gostote, ki je posebej zasnovana za ab-initio molekularno dinamiko. Njegovo prvo različico je razvil Jurg Hutter v IBM Zurich Research Laboratory, ki je začel iz prvotnih kod Car-Parrinello. Trenutna različica 3.5 je avtorsko zaščitena s strani IBM Corp in Max Planck Institute, Stuttgart, in se brezplačno razdeljuje neprofitnim organizacijam. Podpiram normalne in ultrazvočne pseudopotenciale.

Komercialna programska oprema, ki je na voljo pri podjetju Accelrys (prej Molecular Simulations Inc). Celovita namenska konjugatna gradientna pseudopotencialna koda. Vključuje svojo lastno knjižnico uspp-73X-kompatibilnih ultrazvočnih pseudopotencialov.

  • CUSP.

Paket CUSP (Conjugate-gradient UltraSoft Pseudopotential) je bil razvit v skupini D. Vanderbilt v zgodnjih devetdesetih letih in jo v preteklih letih uporabljajo nekateri člani skupine Vanderbilt in več sodelavcev. To je program za skupno energijo in sile, ki je specializiran za učinkovito uporabo ultrazvočnih psevdopotencialov in za uporabo pri izolatorjih. Trenutna najnovejša splošna izdaja je cusp5.6.1. Za nadaljnje podrobnosti se obrnite na dhv@physics.rutgers.edu ali povprašajte o dostopu.

  • CP.

Ta koda trenutno uporablja skupina R. Car na univerzi Princeton. Poleg standardnih varčevalnih psevdonimov podpira tudi ultrazvočne potenciale, ki jih ustvari ta paket, ali tiste iz obrazca “RRKJ3”, omenjene v povezavi s PWSCF zgoraj. Lahko ga prenesete s spletnega mesta http://www.democritos.it/scientific.php.

Druga znana lastna koda, ki uporablja ultrasoftne potenciale, je paket VASP. Vendar pa VASP uporablja ultrasoft potenciale, ustvarjene z uporabo nekoliko drugačne sheme od tistega, ki se izvaja tukaj. Tako se psevdopotenciali, vzeti iz knjižnice, ki so del distribucije VASP, ne morejo uvažati v zgornje kodne pakete in obratno.

Arhiv prejšnjih različic

Arhiv prejšnjih različic paketa uspp je na voljo tukaj. To bi lahko bilo koristno pri reševanju vprašanj združljivosti, povezanih s potenciali, ustvarjenimi s starejšimi različicami kode.

Povratne informacije

Prosimo, pošljite pripombe ali predloge za izboljšavo na dhv@physics.rutgers.edu.

Ugotovitve in izjava o zavrnitvi

Ta spletna stran delno temelji na delu, ki ga podpira Nacionalna znanstvena fundacija ZDA pod št. 9981193, 0233925, 0549198 in 1005838. Mnenja, ugotovitve in sklepi ali priporočila, izražena v tem gradivu, so avtorji in ne nujno odražajo stališča Nacionalne znanstvene fundacije.


Nazaj na domačo stran Vanderbilt.

 

Izvirno angleško besedilo: http://www.physics.rutgers.edu/~dhv/uspp/

Prihodnja evolucija medgalaktičnega medija v vesolju

Prevladuje kozmološka konstanta

Kentaro Nagamine in Abraham Loeb
Harvard-Smithsonian Center za astrofiziko
2004, Nova astronomija, 9, 573

[papir z visoko ločljivostjo: gzipped postscript (683KB) PDF (554KB)]

ADS

[Glej tudi spremljevalni dokument o prihodnjem razvoju bližnjih velikih struktur v vesolju, v katerem prevladuje kosmološka konstanta]


Povzetek:

Simulira evolucijo medgalaktičnega medija (IGM) v vesolju, v katerem prevladuje kosmološka konstanta. Ugotovili smo, da bodo v nekaj Hubblovih časih iz sedanje epohe barioni imeli dve primarni fazi: eno fazo, sestavljeno iz nizkotemperaturnega, razpršenega, ioniziranega plina, ki se eksponentno ohladi s kozmičnim časom zaradi adiabatske ekspanzije, in druga faza plina visoke gostote pri visoki temperaturi v virializiranih halovih temne snovi, ki se z atomskimi procesi ohlaja veliko počasneje. Masni delež plina v halosu konvergira na ~ 40% v poznih časih, približno dvakrat njene izračunane vrednosti v sedanji epohi. Ugotovili smo, da se bodo v nekaj Hubblovih časih velikonokularni filamenti v današnjem IGM redkotirali in utopili v nizko temperaturno IGM, le ostali virializirani plini pa bodo ohranjali svojo fizično strukturo. V kasnejših časih ne najdemo dokazov za razdrobljenost razpršene IGM. Več kot 99% mase plina bo ohranilo stalno ionizacijsko frakcijo nad 80% v nekaj Hubbleovih časih. Razpršeni IGM postane zelo hladen in razredčen, vendar ostane zelo ioniziran, saj bo njegov čas rekombinacije dramatično presegel starost vesolja.


Filmi:

rezina temperatura plina masa plina temna snov
2

Zgoraj navedeni filmi kažejo razvoj predvidene porazdelitve masne teže plina, mase plina in mase temne snovi v komprimirani rezini 50x50x10 Mpc / h. Zgoraj je ista rezina, kot je prikazana v papirju.
Ura prikazuje od leve proti desni, številko posnetka, faktor lestvice, rdeč pomik in kozmični čas v enotah trenutnega časa Hubble tH = 14 Gyr (za h = 0,7). Reionizacija poteka pri z = 6 pri tej simulaciji. Kot smo pokazali v Nagamine & Loeb (2003, New Astronomy, 8, 439), porazdelitev mase temne snovi komaj razvija za t / tH = 3,0. Videli boste, da se temperatura hitro zmanjša za t / tH = 3,0 zaradi eksponentne ekspanzije vesolja.
Ura in slike se morda ne bodo sinhronizirali glede na hitrost prenosa. Filmi se običajno zaokrožijo za 1-2 sličic, če je hitrost prenosa počasna. Temperaturni film nenadoma postane zelen z z = 6, tako da boste vedeli, kdaj ste sinhronizirani. Omogočil sem zanke filma, da se izognem kopiranju sinhronizacije. Če niste sinhronizirali, počakajte, da se prvi film konča, in kliknite »Naloži« ali »Osveži«, da ga znova vidite od začetka. (Ampak sem ugotovil, da se včasih ne obnašajo, kot sem hotel. Na primer, Netscape na mojem računalniku Mac se ne trudi ponovno naložiti filme, ko kliknem na “Reload”. Rezultati so morda odvisni od brskalnika in Zdi se, da IE dobro deluje.)

Želite videti več? Tu so še druge rezine.
Rezina 0  Rezina 1  Rezina 3  Rezina 4

 

Vir: http://www.physics.unlv.edu/~kn/Visual/FutureIGM/

 

 

PRESTO

PRESTO je velika zbirka iskanja pulsarja in programsko opremo za analizo, ki jo je razvil Scott Ransom večinoma iz nič. Zasnovan je bil predvsem za učinkovito iskanje dinarskih milisekundnih pulsarjev iz dolgih opazovanj globularnih grozdov (čeprav se je že od takrat uporabljal v več raziskavah s kratkimi integracijami in obdelal veliko podatkov o rentgenskih žarkih). Napisana je predvsem v ANSI C, z mnogimi nedavnimi podprogrami v Pythonu. Po mnenju Stevea Eikenberryja, PRESTO pomeni: PulsaR Exploration and Search TOolkit!

Do sedaj je PRESTO odkril več kot 300 pulsarjev, od tega več kot 150 recikliranih pulsarjev, večina jih je v binarnih datotekah!

Novo v različici 2:

  • Podatki WAPP, BCPM, Spigot in 1-bitni analogni filtrski podatki so opuščeni! (glej spodaj)
  • Dramatično izboljšana notranja obdelava (boljši dinamični razpon in odstranitev RFI) podatkov PSRFITS in SIGPROC filterbank
  • Velike pospeševalne hitrosti (dejavniki 2 ali več), ko se lahko celotna ravnina F-Fdota prilega v osrednji pomnilnik (ki se lahko nastavi s spreminjanjem vrednosti v vključi / meminfo.h)
  • Veliko popravkov napak in več novih skript (vključno z novimi orbitalnimi serviserji)

O podjetju PRESTO:

V pisni obliki s prenosljivostjo, preprostostjo uporabe in pomnilnikom, lahko trenutno obdeluje neobdelane podatke iz naslednjih pulznih strojev ali oblik:

  • PSRFITS podatkov v formatu iskanja (kot pri GUPPI na GBT, PUPPI in Mock spektrometrih v Arecibu ter veliko novih in arhiviranih podatkov iz Parkov)
  • 1-, 2-, 4-, 8- in 32-bitni (npr. Float) format filtriranja iz SIGPROC
  • Časovno vrsto, sestavljeno iz enotnih natančnosti (tj. 4-bajtnih) podatkov s plavajočo vejico
  • Časi prihoda fotonov (ali dogodki) v ASCII ali dvojni natančni binarni obliki

Upoštevajte, da naslednje oblike, ki jih je bilo podprto, niso:

  • Širokopasovni Arecibo Pulsar procesor (WAPP) v Arecibu
  • 1-bitna oblika filtrskih kartic Parkes in Jodrell Bank
  • SPIGOT na GBT (morda RIP …)
  • Berkeley-Caltech Pulsar Machine (BCPM) na GBT (morda RIP …)

Če jih želite obdelati, lahko preverite “klasično” vejo PRESTO (glej spodaj), ki se ne aktivno razvija. Ali pa lahko uporabite DSPSR za pretvorbo teh formatov v format SIGPROC filterbank (in / ali morda nekega dne kmalu, format iskanja PSRFITS). Tukaj lahko zgrabite DSPSR. Če resnično potrebujete enega od teh strojev, ki delajo v PRESTO v2, mi sporočite in verjetno lahko to storimo. Žrtvica wMSP J2214 + 3000 traja en dan ali dva za prenos za vsak hrbet.

Programska oprema je sestavljena iz številnih rutin, zasnovanih za obdelavo treh glavnih področij analize pulza:

  1. Priprava podatkov: zaznavanje motenj (rfifind) in odstranitev (zapbirds), disperzija (prepdata, predpasubband in mpiprepsubband), barycentering (preko TEMPO).
  2. Iskanje: pospešek Fourier-domene (accelsearch), enojni impulz (single_pulse_search.py) in fazno-modulacija ali bočna iskanja (search_bin).
  3. Zlaganje: optimizacija kandidatov (prepfold) in generacija časov prihoda (TOA) (get_TOAs.py).
  4. Razno: Raziskava podatkov (readfile, exploredat, explorefft), načrtovanje disperzije (DDplan.py), pretvorba datuma (mjd2cal, cal2mjd), ton python pulsar / astro knjižnic, povprečno ustvarjanje impulzov, ocena gostote fluksa in še več. .

Veliko dodatnih pripomočkov je na voljo za različne naloge, ki se pogosto zahtevajo pri obdelavi podatkov s pulsarjem, kot so časovne konverzije, Fourierove transformacije, časovne vrste in raziskovanje FFT, bajtno zamenjava itd.

Tehnika iskanja pospeška Fourier-Domain, ki jo uporablja PRESTO pri rutinskem pospeševanju, je opisana v Ransom, Eikenberry in Middleditch (2002), in tehnika iskanja faze modulacije, ki jo uporablja search_bin, je opisana v Ransom, Cordes in Eikenberry (2003). Nekatere druge osnovne informacije o PRESTO najdete v moji tezi. Sčasoma bom končal dokončanje dokumentacije za PRESTO, vendar do takrat morate vedeti, da vsaka rutina vrne osnovno uporabo, ko jo pokličete brez argumentov. Prav tako sem pripravljen zagotoviti omejeno podporo prek e-pošte ali telefona (434-296-0320).

Pridobivanje to:

Izvirna koda PRESTO se sprosti pod GPL in jo je mogoče brskati ali dobiti od tukaj na več različnih načinov (vključno z zipom ali tar’d ali preko git). Če ste preveč leni, da bi prebrali, kako ga dobite, vendar imate git na vašem sistemu:

> git clone git: //github.com/scottransom/presto.git

Da ga redno posodabljate storite

> cd $ PRESTO
> git pull

in nato ponovno naredite stvari v $ PRESTO / src.

Za podrobnejša navodila za namestitev glejte INSTALL.

Če se ne želite zmotiti z git-om (kar pomeni, da boste morali kadarkoli znova namestiti tarko, ki jo lahko prenesete), jo lahko dobite na povezavi »Prenos vira« na strani github.

Če želite »klasično« vejo, storite naslednje:

> git clone git: //github.com/scottransom/presto.git
> cd presto
> git daljinski dodate klasično poreklo / klasiko
> git checkout -b klasično poreklo / klasika

nato graditi v skladu s (staro) INSTALL datoteko.

Razvoj:

Če nameravate kodirati kodo, zelo priporočam, da uporabite git in klonirate imenik (ali pa ga uporabite z računom na github). Če nameravate narediti kakršen koli pomemben razvoj, mi sporočite, ali vas bom dodal kot razvijalca, ali pa lahko potisnemo / povlečemo spremembe preko git / github. Prispevki kode in / ali popravki za popravljanje napak so dobrodošli!

OPOMBA: PRESTO uporablja za podatkovne barierscenterje TEMPO. Morate dobiti najnovejšo različico iz Sourceforge.
Prav tako boste potrebovali FFTW, CFITSIO in PGPLOT.

Vaje: Zdaj obstaja a vadnica na voljo, ki vam bo pokazala osnove. Vključen je tudi v imenik dokumenta za izvorno kodo.

Končne misli: povejte mi, če se odločite za uporabo PRESTO za kakršna koli “resnična” iskanja. In če najdete kaj s tem, bi bilo super, če bi citiral bodisi svojo diplomsko delo ali katerikoli od dveh zgoraj navedenih dokumentov je primeren. Hvala!

Zahvale: Velika zahvala gre Steve Eikenberryju za pomoč pri razvoju algoritmov, Dunc Lorimer za osnovno kodo, ki se uporablja za obdelavo podatkov BCPM in WAPP, David Kaplan za veliko pomoči s kodo GBT SPIGOT, Jason Hessels za številne prispevke k Python rutine (in skupaj z Maggie Livingstone za rutinsko redukcijo), Anne Archibald (za pomembno pomoč pri nedavnih izboljšavah napredka) in Paul Demorest, Paul Ray, Paul Scholz, Ingrid Stopnice, Fernando Camilo, Cees Bassa, Patrick Lazarus, Mike Keith, Kevin Stovall in Paulo Freire za veliko pripomb in predlogov (in celo nekaj popravkov!).

Scott Ransom

Izvirni članek: http://www.cv.nrao.edu/~sransom/presto/

 

 

Knjige o vzorcni arhitekturi programske opreme

Na tej strani so opisane pet knjig o arhitekturi programske opreme Oriented Architecture (POSA). Vse te knjige objavlja Wiley.

  1. Pattern-Orientirano Arhitektura programske opreme: Sistem vzorcev, zvezek 1

POSA1 je prva serija v seriji POSA in je bila objavljena leta 1996. Ta knjiga predstavlja napredovanje in razvoj vzorčnega pristopa v sistem vzorcev, ki lahko opisujejo in dokumentirajo obsežne aplikacije. Vzorci, predstavljeni v tej knjigi, obsegajo več stopenj abstrakcije od visokokakovostnih arhitekturnih vzorcev in vzorcev srednjega nivoja do nizkih ravni idioma.

2. Pattern-Orientirana Arhitektura programske opreme: vzorci za sočasno in omrežno opremo, zvezek 2

POSA2 je druga serija v seriji POSA in je bila objavljena leta 2000. 17 vzorcev v POSA2 je osnova vzorca jezika, ki obravnava vprašanja, povezana s sočasnostjo in povezovanjem v omrežje. Ta material predstavlja vrsto vzorcev od idiomov do arhitekturnih modelov. Vzorci pokrivajo ključne elemente izgradnje hkratnih in omrežnih sistemov: dostop do storitev in konfiguracija, ravnanje z dogodki, sinhronizacija in vzporednost. Vsi vzorci predstavljajo obsežne primere in znane uporabe vzorca so predstavljene v različnih programskih jezikih, vključno s C ++, C in Java.

3. Pattern-Usmerjena Arhitektura programske opreme: Vzorec za upravljanje virov, zvezek 3

POSA3 je tretja serija v seriji POSA in je bila objavljena leta 2003. Uporablja vzorce za predstavitev tehnik za uvajanje učinkovitega upravljanja virov v sistemu. Modeli so podrobno obravnavani, pri tem pa uporabimo več primerov, in kot v prejšnjih količinah POSA-ov, so podane smeri za izvajanje predstavljenih vzorcev. Poleg tega obseg predstavlja temeljit uvod v upravljanje virov in dve študiji primerov, kjer se vzorci uporabljajo na področjih ad hoc omrežja in mobilnih radijskih omrežij. Modeli so združeni na različnih področjih upravljanja virov in zato obravnavajo celoten življenjski cikel virov: pridobivanje virov, usklajevanje in sprostitev.

4. Pattern-Orientirano Arhitektura programske opreme: Jezik vzorca za porazdeljeno računalništvo, zvezek 4

POSA4 je četrti obseg v seriji POSA in je bil objavljen leta 2007. Opisuje vzorec jezik za porazdeljeno računalništvo, ki usmerja bralce prek najboljših praks in jih uvaja na ključna področja izdelave porazdeljenih sistemov programske opreme. POSA4 povezuje na stotine samostojnih vzorcev, zbirk vzorcev in jezikov vzorcev iz obstoječega dela literature, ki se nahaja v seriji POSA. Takšni vzorci se nanašajo in so koristni za porazdeljeno računalništvo v enem samem jeziku. Knjiga zagotavlja dosleden in koherenten celovit pogled na plovilo v distribucijskih sistemih stavbe.

5. Pattern-orientirana Arhitektura programske opreme: na vzorcih in vzorčnih jezikih, zvezek 5

POSA5 je peta serija v seriji POSA in je bila objavljena leta 2007. Ponuja poglobljen videz, kateri vzorci so, kaj niso in kako jih uspešno uporabiti. Ta knjiga obravnava vprašanje, kakšen je vzorec jezik, in primerja različne paradigme v konceptu vzorca, vključno z vzorčnimi spojinami, dopolnilnimi vzorci, zbirkami vzorcev, vzorčnimi zgodbami in zaporedji vzorcev.


Nazaj na domačo stran vzorcev.

 

Koristna spletna stran: http://www.cs.wustl.edu/~schmidt/POSA/

SwiftVis

Paket za analizo podatkov in vizualizacijo za Swift / Swifter

Napisal Mark Lewis s podporo iz donacije AISRP NASA (Hal Levison PI)


NOVO !!!

1. 9. 2009 – Različica 0.3.0 je objavljena. Obstaja veliko sprememb in popravkov napak tam. Največja sprememba in razlog za prehod na višjo številko različice je dodajanje tokov.

3/26/2009 – Začeli smo izdelovati Wiki za SwiftVis, tako da uporabniki lahko prispevajo k dokumentaciji. Wiki lahko najdete na http://swiftvis.wikidot.com

9.4.2008 – Naložen je posodobljen JAR od 0.2.2. Datoteka je združljiva s staro različico. Zdaj sprejema oblike nizov, ki se konča z d, o ali x za izvajanje konverzij celih števil. Upoštevajte, da je pretvorba iz dvojnega v int okrajšava. Zdaj bo format string%, d dala celo število z vstavljenimi lokaliziranimi separatorji.

8. 11. 2008 – Objavljena je različica 0.2.2. To ima veliko malih nadgradenj in popravkov napak. Ena stvar, ki jo morate opaziti, je, da bo risanje velikih parcel nekoliko hitrejše. Obstaja tudi nelinearni filter za dopolnjevanje filtra za linearno prileganje. Če želite prilegati linearno funkcijo, bo linearni fit filter bolj učinkovit, vendar nelinearni fit filter vam omogoča, da se prilega skoraj vsaki želeni funkciji. Pomaga, da se spodobno uganiti, kaj rešitev. Dodano je tudi osnovno izvajanje 3-D grafike. To je zgodnja implementacija in več funkcij se bo sčasoma dodalo. Pozdravljamo povratne informacije in predloge. Če najdete napake, jih prijavite, da jih lahko hitro popravite. Tu je vadnica na 3-D grafiko v SwiftVis, da vam pomaga začeti.

1/7/2008 – Objavljena je različica 0.2.1. Obstaja nekaj pomembnih novih dodatkov k temu. Največja prihaja iz zahteve uporabnika, da lahko obdeluje veliko datotek brez uporabe grafičnega vmesnika. Torej v SwiftVisu ​​zdaj obstaja možnost obdelave serije. Obstajajo dve različni možnosti za serijsko obdelavo. Več o novem vajah lahko preberete. Za vlečenje podatkov iz več datotek v SwiftVis na drugačen način je bil ustvarjen nov filter, imenovan filter Input Collection. Ta filter sledi elementom, ki pridejo vanj, med več spremembami vhodov. Več o tem, kako jo uporabljati v majhen vaje.. Skupaj s številnimi majhnimi izboljšavami je bil dodan tudi vir PKDGRAV. Ta vir trenutno ne podpira nasvetov. Navedite povratne informacije, če želite dodati. Nova formula je bila dodana formulam, o katerih se razpravlja v novem vadnici, ki se ukvarja s tem, kako narediti filme, ki vključujejo več vzporednih podatkovnih nizov.

9.2.2007 – Objavljena je različica 0.2.0. Ta različica vključuje več sprememb kode za prizori kot v tem, kar nameravate uporabljati. Večina sprememb je bila izvedena pri načrtovanju vidikov kode. Primarne 2-D načrtovalne rutine so bile znatno refaktirirane. To je privedlo tudi do sprememb v načinu delovanja postavitve kompleksnih parcel. Več strani dokumnetacije je bilo posodobljenih, da odražajo te spremembe (stran s plakati, bin.dat tutorial). Morate razmisliti o branju skozi enega od njih. S temi spremembami smo lahko za načrtovanje dodali nekaj novih funkcij. To vključuje sposobnost spreminjanja velikosti vrstic ali stolpcev v mrežah grafikonov ter sposobnost, da osi uporabijo lestvice dnevnika. Postavili so tudi oznake manjših osi, ki so bili dodani. Dodan je bil nov filter, ki vam bo pomagal pri izdelavi površinskega omrežja iz podatkov redkega razprševanja. Imenuje se interpoliran površinski filter. Nazadnje so bile nekatere skripte narejene skripti, ki je bila dodana v zadnji posodobitvi. Ti vam omogočajo, da uporabite zunanji urejevalnik in berete iz binarnih datotek, vključno s tistimi z oblikovanjem Fortran.

Tukaj si oglejte starejše elemente posodobitve.


Prenesite datoteko jar. Prenesite datoteko, ki jo ta povezava prikaže, da dobite najnovejšo različico programa SwiftVis. To je izvedljiva datoteka JAR. Iz ukazne vrstice zaženite “java -jar SwiftVis.jar”. Če ugotovite, da zmanjkuje pomnilnika, lahko uporabite možnost -Xmx. Ta koda je bila posodobljena za uporabo funkcij Java 6. Za zagon programa SwiftVis morate imeti nameščeno različico. Če ne, pojdite tukaj, da ga dobite (potrebujete samo JRE, razen če želite razviti nove komponente). V času, ko pišem to, Apple ni izdal Java 6 za Mac, zato boste morali uporabiti različico SwiftVis pred 0.2.0 ali zagnati SwiftVis na ne-Mac. V operacijskem sistemu Windows lahko preprosto kliknete na ikono datoteke JAR (vendar ne povejte Halu, da uporabljate Windows). Če imate stroj z 1 + GB RAM-a in ste pripravljeni na uporabo SwiftVis precej malo (ali če dobite OutOfMemoryErrors sicer), potem uporabite možnost -Xmx. Postavitev -Xmx1000M pred-jar bo omogočila Java, da po potrebi vzpostavi do 1 GB pomnilnika. Lahko greš tudi višje. Praviloma lahko Javi omogočite varno približno 70% vašega sistemskega RAM-a. Če se zgodi nad tem, lahko pride do močne zamenjave, ki bo bistveno upočasnila vaš stroj. Če na napravi običajno zaženete veliko drugih procesov, boste morda želeli omejiti Java na 50% vašega pomnilnika naprave.

Oglejte si Wiki SwiftVis na http://swiftvis.wikidot.com

Če želite najti starejšo različico SwiftVis, poiščite datoteko JAR tukaj. V nekaterih izvedbah Java lahko ugotovite, da dobite boljšo učinkovitost, če uporabljate možnost -server.

SwiftVis je odprtokodno delo v teku. Če najdete hrošče ali želite prispevke, se obrnite na mene na naslovu mlewis@trinity.edu. Ne nadgradite na novejšo različico SwiftVis rahlo. Verjetno bi morali obdržati svojo starejšo datoteko JAR. Razlog je, da če se podatki v določenih elementih spremenijo, bodo vaše prejšnje shranjene datoteke in predloge verjetno neveljavne v novejši različici.

Ta dokumentacija je na voljo kot gzip tarball tukaj.


SwiftVis je paket za analizo podatkov in vizualizacijo, ki je bil napisan predvsem za uporabo s programoma Swift in Swifter. Vendar paketa vključuje tudi splošno funkcionalnost in razširljivost, tako da jo je mogoče uporabljati tudi z drugimi vrstami podatkov (na primer z uporabo podatkov planetnega obroča). V Javi je bilo napisano, da je lahko uporabno na različnih platformah.

Paket SwiftVis temelji na temeljni zasnovi, ki ima vire podatkov, ki se povežejo prek več filtrov za obdelavo elementov podatkov in ki gredo na ploskve, ki prikazujejo podatke. Posamezni elementi vsebujejo vektorje parametrov in vrednosti. Spodaj so navedeni seznami virov, filtrov in slogov, ki so del običajne aplikacije SwiftVis. Druge lahko ustvarijo uporabniki, da izpolnijo bolj specifične potrebe. Uporabniki jih lahko pošljejo v glavni paket, tako da imajo drugi tudi dostop do njih. Glavno okolje SwiftVis je razdeljeno na dve regiji, tista, ki prikazuje graf povezanih virov, filtrov in ploskev ter drugo, ki prikazuje lastnosti elementa, izbranega v grafu. Naslednja seja v SwiftVis je prikazana spodaj z grafiko, ki se generira.

Prilagodljivost, ki jo zagotavlja zasnova SwiftVis, je pomembna, vendar lahko zaradi tega pride do učne krivulje. Iz tega razloga vam ponujamo nekaj osnovnih informacij in številne vaje, ki vas vodijo skozi korake, s katerimi se ukvarjate s SwiftVis.


Viri

Swift binarni podatki o položaju – Ta vir se bere v primarni izhodni datoteki podjetja Swift

Podatki o zavrženju Swift – ta vir se prikaže v podatkih o zavržku podjetja Swift

Podatki Swift dump – Ta vir bo prebral v različnih datotekah iz datoteke Swift, če je vse, kar morate analizirati, zadnji čas simulacije.

Podatki o Swift naletu – Ta vir se bere v podatkih o srečanju podjetja Swift

Splošne podatkovne datoteke – omogoča branje skoraj vseh besedilnih ali binarnih datotek.

Izvor SPH – vir za branje v binarnih podatkovnih datotekah SPH.

Zaporedja – Ta vir ne prebere datoteke, ampak namesto tega proizvaja linearno zaporedje vrednosti, ki jih je mogoče preiti skozi filtre, ne da bi prisilili uporabnike k ustvarjanju preprostih “lažnih” datotek.

Vir sheme – Ta vir vam omogoča, da napišete kodo SVScheme za branje podatkov iz datotek in jih naredite iz SwiftVis elementov. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Fixed 2D binned source – Ta vir v binarnih podatkovnih datotekah C sloga bere podatke, ki so že binned.

Virus delcev 2D – Ta izvor bere binarne podatkovne datoteke v slogu C za podatke, ki jih binarni delci namesto prostorske lokacije.

Košarica in Rad Vir – to bere binarno datoteko sloga C, ki vsebuje binarni odlagališče delcev in polmerov.


Filtri

Izbirni filter – ta filter izbere elemente prvega vira, ki temelji na določenih pogojih uporabnika.

Filter za redčenje – Ta filter je zasnovan tako, da naredi bolj enakomerno zmanjševanje podatkov. To vam lahko pomaga pri hitrem pregledu informacij brez obdelave vseh podatkov v viru.

Ključni izbirni filter – ta drugi izbirni filter, vendar je ta namen izbrati predmete iz ene datoteke na podlagi vrednosti v drugi datoteki.

Funkcijski filter – ta filter bo pretvoril podatke z uporabniškimi določenimi funkcijami. Lahko se uporablja tudi za združitev dveh vzporednih nizov podatkov v eno zbirko.

Konvertorski filter za pretvorbo – bo pretvoril iz orbitalnih elementov v heliocentrični in nazaj. Vključuje tudi konverzije za barientrične koordinate in koordinate vodilnega središča, ki se uporabljajo pri lokalnih simulacijah obroča.

Filter za spajanje – ta filter preprosto zajema dva ali več podatkovnih nizov in proizvaja in posamezen, ki je povezava obeh.

Masni filter – ta filter doda množice iz podatkovne datoteke planeta na elemente, ki se prebirajo iz vira binarnega položaja. Lahko dodaja elemente za osrednjo zvezdo.

SyMBA masni filter – ta filter bo dodal podatke o masi in združitvi v vir binarnega položaja.

Sortiraj filter – ta filter bo razvrščal vse elemente na podlagi določene formule ali vrednosti.

Binned filter – Ta filter bo ustvaril podatke, podobne histogramom, iz nabora podatkov v več dimenzijah.

Filtri filma – Ta filter omogoča prek okna podatkov iz vira. Ima funkcionalnost, tako da lahko preprosto premikate okno skozi podatke. To se lahko uporabi za prikaz, kako se sistem sčasoma razvija.

Sheme filter – Ta filter vam omogoča, da napišete kodo SVScheme, ki filtrira podatke. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Filter za številčenje skupine – To je predvsem, če vlečete v zunanjo zbirko podatkov, kjer so podatki v skupinah, vendar elementi skupin niso oštevilčeni. Skupine tudi štejejo same.

Wake vrh filter – Kot je mogoče uganiti iz imena, je bil ta filter namenjen za uporabo z planetarni obroč simulacijo podatkov, da potegne lokacije Wake peaks iz površinske ploskve. Najde lokalni maksimum vzdolž rezin skozi podatkovni niz, tako da se lahko uporabi z drugimi podatki, da bi našli stvari, kot so točke največje ekscentričnosti za delce.

Filter za izbiro regije (Poslušalec) – Ta filter izbere pravokotno območje tako, da sprejme samo elemente, ki v določenem obsegu spadajo v dve dimenziji. Prav tako je poslušalec, zato ga lahko nastavite tako, da kliknete vnos iz ploskev in premaknete regijo za ogled ali ustrezno povečate.

Filter za izbiro rezin (poslušalec) – ta filter izbere elemente na določeni razdalji okoli rezine skozi podatkovni niz. Rezine so narejene v 2-D prostoru bodisi navpično, vodoravno ali vzdolž poljubnega segmenta. Podatki so izboljšani z razdaljo in položajem vzdolž rezine. To je poslušalec, tako da lahko najdete rezine s klikom na ploskve.

Rotacijski filter (Poslušalnik) – Ta filter vam omogoča, da spremenite podatke z vrtenjem ali drugimi transformacijami. Za olajšanje uporabe je potreben vnos kot poslušalec.

Urejevalnik elementov elementov – Omogoča preglednico kot sposobnost hitrih opravil.

Count Rebin Filter – s tem boste ponovno združili podatke vzdolž skupin. Določite, koliko podatkov naj se prenese v vsakega od novih zabojnikov.

Linearni Fit Filter – Ali linearno ustreza podatkom. To dejansko doda v dva filtra. Tisti, ki oddaja parametre fit in drugi, ki oddaja ustrezne vrednosti.


Ponori

Slušalec za pomivalno statistiko – ta ponor bo prikazal statistične podatke o vhodih, ki jih vsebuje, vključno z min, max in std za vsak parameter in vrednost. Prav tako je poslušalec in bo zabeležil lokacijo klikov v besedilnem območju, iz katerega je mogoče kopirati.


Plotiranje

Element ploskve – to je element, ki ga postavite v graf. Ima veliko lastnih možnosti poleg tega, da lahko prikaže več različnih slogov.

Plaster plot – To je standardni slog oblikovanja, ki je določen v splošnem 2-D SwiftVis načrtovanju mehanizma.

Pravokotna površina – to je za osnovne površine. Namenjen je uporabi s filtrom za bin.

Orbitska parcela – s tem bo potegnjena orbita teles. Predpostavlja, da je vnos v orbitalnih elementih datoteke Swift.

Vektivno polje – Ta slog pozicije posname in jih odpre, da prikaže vektorska polja.

Shema sheme – to je slog ploskve, ki vam omogoča, da napišete SVScheme kodo, ki bo za vas naredila custom cropping. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Image adder – Ta slog ploskve bo v ploskev dodal skalirano sliko. To je priročen način, da dodate zunanjo grafiko v ploskev ali celo samo, da postavite osi na slike, ustvarjene z drugimi orodji.

Streamlines – Ta slog plesa je bil razvit za nekaj dela v dinamiki obroča. V bistvu povezuje točke v nizu podatkov. To vedenje je lahko podrejeno s filtrom za številčenje skupin in razpršenim grafom.

Splošna površina – To je bilo razvito tudi za dinamiko obroča, ampak služi tudi kot močnejša oblika površinskega plotterja. Medtem ko se lahko uporablja s filtriranim filtrom na enak način kot pravokotna površina, ima sposobnost, da površine na površini naredijo neresnične in lahko na eni površini zasidra do tri nabora podatkov.

Iso Line Surface – s črtami stalne vrednosti čez površino. Lahko se prekrivajo na pravokotni površini, na splošno površino ali pa samo vlečeni sami.


Javadocs

Vir: http://www.cs.trinity.edu/~mlewis/SwiftVis/

 

Vizualizacija podobnosti človeške in šimpanzne DNA

Eamonn Keogh, Stefano Lonardi, Victor B. Zordan, Sang-Hee Lee in Manel Jara.

Univerza v Kaliforniji – Riverside
Riverside, CA 92521

Nedavna objava popolnega genoma šimpanza, ki jo zaznamuje praznična številka revije Nature, nam pove, da imajo ljudje in šimpanzi 96 odstotkov istega genskega materiala. Ta številka je težko razumeti, kaj natančno pomeni, da imamo 96% naše DNK z najbližjimi bratranci v življenju?

Neposredna preiskava DNK samega sebe ne pomaga. Na primer, razmislite o prvih 100 baznih parov šimpanskih mitohondrijskih DNA:

  • gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcaccccataaacaaacaggtttggtcctagcctttctattag …

in prvih 100 baznih parov humane mitohondrijske DNA:

  • gatcacaggtctatcacctattaaccactcacgggagctctccatgcatttggtattttcgtctggggggtgtgcacgcgatagcattgcgagacgctg …

Zelo težko je izmeriti podobnost, poln genoma za ljudi in šimpanz pa je dejansko približno 3 milijarde baznih parov!

Izdelali smo preprosto orodje, ki ljudem omogoča vizualizacijo in razumevanje podobnosti / neskladnosti zaporedij DNA. Čeprav je to delo trenutno neobjavljeno in še vedno poteka, smo izdali videoposnetek, ki se nanaša na človeško in šimpansko DNK, ki sovpada z objavo celotnega genomskega šimpanza.

Videoposnetek je približno 2 minuti dolg in popolnoma samodejen. Spodaj je različica Youtube, morda si boste raje ogledali mnogo samostojnejših različic večje ločljivosti spodaj.

  • Googlova video različica je tukaj.
  • Igrajte različice Quicktime v brskalniku: Opozorilo, najboljša kakovost, vendar velika datoteka. Pred predvajanjem videoposnetka lahko traja nekaj minut.
  • Igrajte različico AVI v brskalniku.
  • Igrajte različico MP4 v brskalniku.
  • Desni klik za prenos različice Quicktime: Opozorilo, velika datoteka (prost igralec).
  • Desni klik za prenos različice AVI
  • Desni klik za prenos različice MP4

 

Kratek bios udeležencev:

  • Dr. Eamonn Keogh je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo podatkovno rudarjenje in vizualizacijo.
  • Dr. Stefano Lonardi je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo računalniško molekularno biologijo.
  • Dr. Victor B. Zordan je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo računalniško grafiko.
  • Dr. Sang-Hee Lee je asistent profesor antropologije pri UCR. Njeni raziskovalni interesi vključujejo človeški razvoj in taksonomijo.
  • Manel Jara je študent računalništva na avtonomni univerzi v Barceloni in leta 2005 obiskoval študent na UCR.

 

Če želite omeniti to delo, prosimo, uporabite:

E. Keogh, S. Lonardi, V. B. Zordan, S.H. Lee in M. Jara (2005). Vizualizacija podobnosti človeške in šimpanzne DNA. (Multimedijski video). http://www.cs.ucr.edu/~eamonn/DNA/

Hvala za pomoč in predloge Colin Crenshaw, Bill Yuan-chi Chiu in Anwar Adi. Glasba v videoposnetku je Chopin – Ballade No. 4 in f minor, Op.52, Andante con moto, ki ga je izvajal dr. Sang-Hee Lee.

 

Vir: http://www.cs.ucr.edu/~eamonn/DNA/