Prihodnja evolucija medgalaktičnega medija v vesolju

Prevladuje kozmološka konstanta

Kentaro Nagamine in Abraham Loeb
Harvard-Smithsonian Center za astrofiziko
2004, Nova astronomija, 9, 573

[papir z visoko ločljivostjo: gzipped postscript (683KB) PDF (554KB)]

ADS

[Glej tudi spremljevalni dokument o prihodnjem razvoju bližnjih velikih struktur v vesolju, v katerem prevladuje kosmološka konstanta]


Povzetek:

Simulira evolucijo medgalaktičnega medija (IGM) v vesolju, v katerem prevladuje kosmološka konstanta. Ugotovili smo, da bodo v nekaj Hubblovih časih iz sedanje epohe barioni imeli dve primarni fazi: eno fazo, sestavljeno iz nizkotemperaturnega, razpršenega, ioniziranega plina, ki se eksponentno ohladi s kozmičnim časom zaradi adiabatske ekspanzije, in druga faza plina visoke gostote pri visoki temperaturi v virializiranih halovih temne snovi, ki se z atomskimi procesi ohlaja veliko počasneje. Masni delež plina v halosu konvergira na ~ 40% v poznih časih, približno dvakrat njene izračunane vrednosti v sedanji epohi. Ugotovili smo, da se bodo v nekaj Hubblovih časih velikonokularni filamenti v današnjem IGM redkotirali in utopili v nizko temperaturno IGM, le ostali virializirani plini pa bodo ohranjali svojo fizično strukturo. V kasnejših časih ne najdemo dokazov za razdrobljenost razpršene IGM. Več kot 99% mase plina bo ohranilo stalno ionizacijsko frakcijo nad 80% v nekaj Hubbleovih časih. Razpršeni IGM postane zelo hladen in razredčen, vendar ostane zelo ioniziran, saj bo njegov čas rekombinacije dramatično presegel starost vesolja.


Filmi:

rezina temperatura plina masa plina temna snov
2

Zgoraj navedeni filmi kažejo razvoj predvidene porazdelitve masne teže plina, mase plina in mase temne snovi v komprimirani rezini 50x50x10 Mpc / h. Zgoraj je ista rezina, kot je prikazana v papirju.
Ura prikazuje od leve proti desni, številko posnetka, faktor lestvice, rdeč pomik in kozmični čas v enotah trenutnega časa Hubble tH = 14 Gyr (za h = 0,7). Reionizacija poteka pri z = 6 pri tej simulaciji. Kot smo pokazali v Nagamine & Loeb (2003, New Astronomy, 8, 439), porazdelitev mase temne snovi komaj razvija za t / tH = 3,0. Videli boste, da se temperatura hitro zmanjša za t / tH = 3,0 zaradi eksponentne ekspanzije vesolja.
Ura in slike se morda ne bodo sinhronizirali glede na hitrost prenosa. Filmi se običajno zaokrožijo za 1-2 sličic, če je hitrost prenosa počasna. Temperaturni film nenadoma postane zelen z z = 6, tako da boste vedeli, kdaj ste sinhronizirani. Omogočil sem zanke filma, da se izognem kopiranju sinhronizacije. Če niste sinhronizirali, počakajte, da se prvi film konča, in kliknite »Naloži« ali »Osveži«, da ga znova vidite od začetka. (Ampak sem ugotovil, da se včasih ne obnašajo, kot sem hotel. Na primer, Netscape na mojem računalniku Mac se ne trudi ponovno naložiti filme, ko kliknem na “Reload”. Rezultati so morda odvisni od brskalnika in Zdi se, da IE dobro deluje.)

Želite videti več? Tu so še druge rezine.
Rezina 0  Rezina 1  Rezina 3  Rezina 4

 

Vir: http://www.physics.unlv.edu/~kn/Visual/FutureIGM/

 

 

PRESTO

PRESTO je velika zbirka iskanja pulsarja in programsko opremo za analizo, ki jo je razvil Scott Ransom večinoma iz nič. Zasnovan je bil predvsem za učinkovito iskanje dinarskih milisekundnih pulsarjev iz dolgih opazovanj globularnih grozdov (čeprav se je že od takrat uporabljal v več raziskavah s kratkimi integracijami in obdelal veliko podatkov o rentgenskih žarkih). Napisana je predvsem v ANSI C, z mnogimi nedavnimi podprogrami v Pythonu. Po mnenju Stevea Eikenberryja, PRESTO pomeni: PulsaR Exploration and Search TOolkit!

Do sedaj je PRESTO odkril več kot 300 pulsarjev, od tega več kot 150 recikliranih pulsarjev, večina jih je v binarnih datotekah!

Novo v različici 2:

  • Podatki WAPP, BCPM, Spigot in 1-bitni analogni filtrski podatki so opuščeni! (glej spodaj)
  • Dramatično izboljšana notranja obdelava (boljši dinamični razpon in odstranitev RFI) podatkov PSRFITS in SIGPROC filterbank
  • Velike pospeševalne hitrosti (dejavniki 2 ali več), ko se lahko celotna ravnina F-Fdota prilega v osrednji pomnilnik (ki se lahko nastavi s spreminjanjem vrednosti v vključi / meminfo.h)
  • Veliko popravkov napak in več novih skript (vključno z novimi orbitalnimi serviserji)

O podjetju PRESTO:

V pisni obliki s prenosljivostjo, preprostostjo uporabe in pomnilnikom, lahko trenutno obdeluje neobdelane podatke iz naslednjih pulznih strojev ali oblik:

  • PSRFITS podatkov v formatu iskanja (kot pri GUPPI na GBT, PUPPI in Mock spektrometrih v Arecibu ter veliko novih in arhiviranih podatkov iz Parkov)
  • 1-, 2-, 4-, 8- in 32-bitni (npr. Float) format filtriranja iz SIGPROC
  • Časovno vrsto, sestavljeno iz enotnih natančnosti (tj. 4-bajtnih) podatkov s plavajočo vejico
  • Časi prihoda fotonov (ali dogodki) v ASCII ali dvojni natančni binarni obliki

Upoštevajte, da naslednje oblike, ki jih je bilo podprto, niso:

  • Širokopasovni Arecibo Pulsar procesor (WAPP) v Arecibu
  • 1-bitna oblika filtrskih kartic Parkes in Jodrell Bank
  • SPIGOT na GBT (morda RIP …)
  • Berkeley-Caltech Pulsar Machine (BCPM) na GBT (morda RIP …)

Če jih želite obdelati, lahko preverite “klasično” vejo PRESTO (glej spodaj), ki se ne aktivno razvija. Ali pa lahko uporabite DSPSR za pretvorbo teh formatov v format SIGPROC filterbank (in / ali morda nekega dne kmalu, format iskanja PSRFITS). Tukaj lahko zgrabite DSPSR. Če resnično potrebujete enega od teh strojev, ki delajo v PRESTO v2, mi sporočite in verjetno lahko to storimo. Žrtvica wMSP J2214 + 3000 traja en dan ali dva za prenos za vsak hrbet.

Programska oprema je sestavljena iz številnih rutin, zasnovanih za obdelavo treh glavnih področij analize pulza:

  1. Priprava podatkov: zaznavanje motenj (rfifind) in odstranitev (zapbirds), disperzija (prepdata, predpasubband in mpiprepsubband), barycentering (preko TEMPO).
  2. Iskanje: pospešek Fourier-domene (accelsearch), enojni impulz (single_pulse_search.py) in fazno-modulacija ali bočna iskanja (search_bin).
  3. Zlaganje: optimizacija kandidatov (prepfold) in generacija časov prihoda (TOA) (get_TOAs.py).
  4. Razno: Raziskava podatkov (readfile, exploredat, explorefft), načrtovanje disperzije (DDplan.py), pretvorba datuma (mjd2cal, cal2mjd), ton python pulsar / astro knjižnic, povprečno ustvarjanje impulzov, ocena gostote fluksa in še več. .

Veliko dodatnih pripomočkov je na voljo za različne naloge, ki se pogosto zahtevajo pri obdelavi podatkov s pulsarjem, kot so časovne konverzije, Fourierove transformacije, časovne vrste in raziskovanje FFT, bajtno zamenjava itd.

Tehnika iskanja pospeška Fourier-Domain, ki jo uporablja PRESTO pri rutinskem pospeševanju, je opisana v Ransom, Eikenberry in Middleditch (2002), in tehnika iskanja faze modulacije, ki jo uporablja search_bin, je opisana v Ransom, Cordes in Eikenberry (2003). Nekatere druge osnovne informacije o PRESTO najdete v moji tezi. Sčasoma bom končal dokončanje dokumentacije za PRESTO, vendar do takrat morate vedeti, da vsaka rutina vrne osnovno uporabo, ko jo pokličete brez argumentov. Prav tako sem pripravljen zagotoviti omejeno podporo prek e-pošte ali telefona (434-296-0320).

Pridobivanje to:

Izvirna koda PRESTO se sprosti pod GPL in jo je mogoče brskati ali dobiti od tukaj na več različnih načinov (vključno z zipom ali tar’d ali preko git). Če ste preveč leni, da bi prebrali, kako ga dobite, vendar imate git na vašem sistemu:

> git clone git: //github.com/scottransom/presto.git

Da ga redno posodabljate storite

> cd $ PRESTO
> git pull

in nato ponovno naredite stvari v $ PRESTO / src.

Za podrobnejša navodila za namestitev glejte INSTALL.

Če se ne želite zmotiti z git-om (kar pomeni, da boste morali kadarkoli znova namestiti tarko, ki jo lahko prenesete), jo lahko dobite na povezavi »Prenos vira« na strani github.

Če želite »klasično« vejo, storite naslednje:

> git clone git: //github.com/scottransom/presto.git
> cd presto
> git daljinski dodate klasično poreklo / klasiko
> git checkout -b klasično poreklo / klasika

nato graditi v skladu s (staro) INSTALL datoteko.

Razvoj:

Če nameravate kodirati kodo, zelo priporočam, da uporabite git in klonirate imenik (ali pa ga uporabite z računom na github). Če nameravate narediti kakršen koli pomemben razvoj, mi sporočite, ali vas bom dodal kot razvijalca, ali pa lahko potisnemo / povlečemo spremembe preko git / github. Prispevki kode in / ali popravki za popravljanje napak so dobrodošli!

OPOMBA: PRESTO uporablja za podatkovne barierscenterje TEMPO. Morate dobiti najnovejšo različico iz Sourceforge.
Prav tako boste potrebovali FFTW, CFITSIO in PGPLOT.

Vaje: Zdaj obstaja a vadnica na voljo, ki vam bo pokazala osnove. Vključen je tudi v imenik dokumenta za izvorno kodo.

Končne misli: povejte mi, če se odločite za uporabo PRESTO za kakršna koli “resnična” iskanja. In če najdete kaj s tem, bi bilo super, če bi citiral bodisi svojo diplomsko delo ali katerikoli od dveh zgoraj navedenih dokumentov je primeren. Hvala!

Zahvale: Velika zahvala gre Steve Eikenberryju za pomoč pri razvoju algoritmov, Dunc Lorimer za osnovno kodo, ki se uporablja za obdelavo podatkov BCPM in WAPP, David Kaplan za veliko pomoči s kodo GBT SPIGOT, Jason Hessels za številne prispevke k Python rutine (in skupaj z Maggie Livingstone za rutinsko redukcijo), Anne Archibald (za pomembno pomoč pri nedavnih izboljšavah napredka) in Paul Demorest, Paul Ray, Paul Scholz, Ingrid Stopnice, Fernando Camilo, Cees Bassa, Patrick Lazarus, Mike Keith, Kevin Stovall in Paulo Freire za veliko pripomb in predlogov (in celo nekaj popravkov!).

Scott Ransom

Izvirni članek: http://www.cv.nrao.edu/~sransom/presto/

 

 

Knjige o vzorcni arhitekturi programske opreme

Na tej strani so opisane pet knjig o arhitekturi programske opreme Oriented Architecture (POSA). Vse te knjige objavlja Wiley.

  1. Pattern-Orientirano Arhitektura programske opreme: Sistem vzorcev, zvezek 1

POSA1 je prva serija v seriji POSA in je bila objavljena leta 1996. Ta knjiga predstavlja napredovanje in razvoj vzorčnega pristopa v sistem vzorcev, ki lahko opisujejo in dokumentirajo obsežne aplikacije. Vzorci, predstavljeni v tej knjigi, obsegajo več stopenj abstrakcije od visokokakovostnih arhitekturnih vzorcev in vzorcev srednjega nivoja do nizkih ravni idioma.

2. Pattern-Orientirana Arhitektura programske opreme: vzorci za sočasno in omrežno opremo, zvezek 2

POSA2 je druga serija v seriji POSA in je bila objavljena leta 2000. 17 vzorcev v POSA2 je osnova vzorca jezika, ki obravnava vprašanja, povezana s sočasnostjo in povezovanjem v omrežje. Ta material predstavlja vrsto vzorcev od idiomov do arhitekturnih modelov. Vzorci pokrivajo ključne elemente izgradnje hkratnih in omrežnih sistemov: dostop do storitev in konfiguracija, ravnanje z dogodki, sinhronizacija in vzporednost. Vsi vzorci predstavljajo obsežne primere in znane uporabe vzorca so predstavljene v različnih programskih jezikih, vključno s C ++, C in Java.

3. Pattern-Usmerjena Arhitektura programske opreme: Vzorec za upravljanje virov, zvezek 3

POSA3 je tretja serija v seriji POSA in je bila objavljena leta 2003. Uporablja vzorce za predstavitev tehnik za uvajanje učinkovitega upravljanja virov v sistemu. Modeli so podrobno obravnavani, pri tem pa uporabimo več primerov, in kot v prejšnjih količinah POSA-ov, so podane smeri za izvajanje predstavljenih vzorcev. Poleg tega obseg predstavlja temeljit uvod v upravljanje virov in dve študiji primerov, kjer se vzorci uporabljajo na področjih ad hoc omrežja in mobilnih radijskih omrežij. Modeli so združeni na različnih področjih upravljanja virov in zato obravnavajo celoten življenjski cikel virov: pridobivanje virov, usklajevanje in sprostitev.

4. Pattern-Orientirano Arhitektura programske opreme: Jezik vzorca za porazdeljeno računalništvo, zvezek 4

POSA4 je četrti obseg v seriji POSA in je bil objavljen leta 2007. Opisuje vzorec jezik za porazdeljeno računalništvo, ki usmerja bralce prek najboljših praks in jih uvaja na ključna področja izdelave porazdeljenih sistemov programske opreme. POSA4 povezuje na stotine samostojnih vzorcev, zbirk vzorcev in jezikov vzorcev iz obstoječega dela literature, ki se nahaja v seriji POSA. Takšni vzorci se nanašajo in so koristni za porazdeljeno računalništvo v enem samem jeziku. Knjiga zagotavlja dosleden in koherenten celovit pogled na plovilo v distribucijskih sistemih stavbe.

5. Pattern-orientirana Arhitektura programske opreme: na vzorcih in vzorčnih jezikih, zvezek 5

POSA5 je peta serija v seriji POSA in je bila objavljena leta 2007. Ponuja poglobljen videz, kateri vzorci so, kaj niso in kako jih uspešno uporabiti. Ta knjiga obravnava vprašanje, kakšen je vzorec jezik, in primerja različne paradigme v konceptu vzorca, vključno z vzorčnimi spojinami, dopolnilnimi vzorci, zbirkami vzorcev, vzorčnimi zgodbami in zaporedji vzorcev.


Nazaj na domačo stran vzorcev.

 

Koristna spletna stran: http://www.cs.wustl.edu/~schmidt/POSA/

SwiftVis

Paket za analizo podatkov in vizualizacijo za Swift / Swifter

Napisal Mark Lewis s podporo iz donacije AISRP NASA (Hal Levison PI)


NOVO !!!

1. 9. 2009 – Različica 0.3.0 je objavljena. Obstaja veliko sprememb in popravkov napak tam. Največja sprememba in razlog za prehod na višjo številko različice je dodajanje tokov.

3/26/2009 – Začeli smo izdelovati Wiki za SwiftVis, tako da uporabniki lahko prispevajo k dokumentaciji. Wiki lahko najdete na http://swiftvis.wikidot.com

9.4.2008 – Naložen je posodobljen JAR od 0.2.2. Datoteka je združljiva s staro različico. Zdaj sprejema oblike nizov, ki se konča z d, o ali x za izvajanje konverzij celih števil. Upoštevajte, da je pretvorba iz dvojnega v int okrajšava. Zdaj bo format string%, d dala celo število z vstavljenimi lokaliziranimi separatorji.

8. 11. 2008 – Objavljena je različica 0.2.2. To ima veliko malih nadgradenj in popravkov napak. Ena stvar, ki jo morate opaziti, je, da bo risanje velikih parcel nekoliko hitrejše. Obstaja tudi nelinearni filter za dopolnjevanje filtra za linearno prileganje. Če želite prilegati linearno funkcijo, bo linearni fit filter bolj učinkovit, vendar nelinearni fit filter vam omogoča, da se prilega skoraj vsaki želeni funkciji. Pomaga, da se spodobno uganiti, kaj rešitev. Dodano je tudi osnovno izvajanje 3-D grafike. To je zgodnja implementacija in več funkcij se bo sčasoma dodalo. Pozdravljamo povratne informacije in predloge. Če najdete napake, jih prijavite, da jih lahko hitro popravite. Tu je vadnica na 3-D grafiko v SwiftVis, da vam pomaga začeti.

1/7/2008 – Objavljena je različica 0.2.1. Obstaja nekaj pomembnih novih dodatkov k temu. Največja prihaja iz zahteve uporabnika, da lahko obdeluje veliko datotek brez uporabe grafičnega vmesnika. Torej v SwiftVisu ​​zdaj obstaja možnost obdelave serije. Obstajajo dve različni možnosti za serijsko obdelavo. Več o novem vajah lahko preberete. Za vlečenje podatkov iz več datotek v SwiftVis na drugačen način je bil ustvarjen nov filter, imenovan filter Input Collection. Ta filter sledi elementom, ki pridejo vanj, med več spremembami vhodov. Več o tem, kako jo uporabljati v majhen vaje.. Skupaj s številnimi majhnimi izboljšavami je bil dodan tudi vir PKDGRAV. Ta vir trenutno ne podpira nasvetov. Navedite povratne informacije, če želite dodati. Nova formula je bila dodana formulam, o katerih se razpravlja v novem vadnici, ki se ukvarja s tem, kako narediti filme, ki vključujejo več vzporednih podatkovnih nizov.

9.2.2007 – Objavljena je različica 0.2.0. Ta različica vključuje več sprememb kode za prizori kot v tem, kar nameravate uporabljati. Večina sprememb je bila izvedena pri načrtovanju vidikov kode. Primarne 2-D načrtovalne rutine so bile znatno refaktirirane. To je privedlo tudi do sprememb v načinu delovanja postavitve kompleksnih parcel. Več strani dokumnetacije je bilo posodobljenih, da odražajo te spremembe (stran s plakati, bin.dat tutorial). Morate razmisliti o branju skozi enega od njih. S temi spremembami smo lahko za načrtovanje dodali nekaj novih funkcij. To vključuje sposobnost spreminjanja velikosti vrstic ali stolpcev v mrežah grafikonov ter sposobnost, da osi uporabijo lestvice dnevnika. Postavili so tudi oznake manjših osi, ki so bili dodani. Dodan je bil nov filter, ki vam bo pomagal pri izdelavi površinskega omrežja iz podatkov redkega razprševanja. Imenuje se interpoliran površinski filter. Nazadnje so bile nekatere skripte narejene skripti, ki je bila dodana v zadnji posodobitvi. Ti vam omogočajo, da uporabite zunanji urejevalnik in berete iz binarnih datotek, vključno s tistimi z oblikovanjem Fortran.

Tukaj si oglejte starejše elemente posodobitve.


Prenesite datoteko jar. Prenesite datoteko, ki jo ta povezava prikaže, da dobite najnovejšo različico programa SwiftVis. To je izvedljiva datoteka JAR. Iz ukazne vrstice zaženite “java -jar SwiftVis.jar”. Če ugotovite, da zmanjkuje pomnilnika, lahko uporabite možnost -Xmx. Ta koda je bila posodobljena za uporabo funkcij Java 6. Za zagon programa SwiftVis morate imeti nameščeno različico. Če ne, pojdite tukaj, da ga dobite (potrebujete samo JRE, razen če želite razviti nove komponente). V času, ko pišem to, Apple ni izdal Java 6 za Mac, zato boste morali uporabiti različico SwiftVis pred 0.2.0 ali zagnati SwiftVis na ne-Mac. V operacijskem sistemu Windows lahko preprosto kliknete na ikono datoteke JAR (vendar ne povejte Halu, da uporabljate Windows). Če imate stroj z 1 + GB RAM-a in ste pripravljeni na uporabo SwiftVis precej malo (ali če dobite OutOfMemoryErrors sicer), potem uporabite možnost -Xmx. Postavitev -Xmx1000M pred-jar bo omogočila Java, da po potrebi vzpostavi do 1 GB pomnilnika. Lahko greš tudi višje. Praviloma lahko Javi omogočite varno približno 70% vašega sistemskega RAM-a. Če se zgodi nad tem, lahko pride do močne zamenjave, ki bo bistveno upočasnila vaš stroj. Če na napravi običajno zaženete veliko drugih procesov, boste morda želeli omejiti Java na 50% vašega pomnilnika naprave.

Oglejte si Wiki SwiftVis na http://swiftvis.wikidot.com

Če želite najti starejšo različico SwiftVis, poiščite datoteko JAR tukaj. V nekaterih izvedbah Java lahko ugotovite, da dobite boljšo učinkovitost, če uporabljate možnost -server.

SwiftVis je odprtokodno delo v teku. Če najdete hrošče ali želite prispevke, se obrnite na mene na naslovu mlewis@trinity.edu. Ne nadgradite na novejšo različico SwiftVis rahlo. Verjetno bi morali obdržati svojo starejšo datoteko JAR. Razlog je, da če se podatki v določenih elementih spremenijo, bodo vaše prejšnje shranjene datoteke in predloge verjetno neveljavne v novejši različici.

Ta dokumentacija je na voljo kot gzip tarball tukaj.


SwiftVis je paket za analizo podatkov in vizualizacijo, ki je bil napisan predvsem za uporabo s programoma Swift in Swifter. Vendar paketa vključuje tudi splošno funkcionalnost in razširljivost, tako da jo je mogoče uporabljati tudi z drugimi vrstami podatkov (na primer z uporabo podatkov planetnega obroča). V Javi je bilo napisano, da je lahko uporabno na različnih platformah.

Paket SwiftVis temelji na temeljni zasnovi, ki ima vire podatkov, ki se povežejo prek več filtrov za obdelavo elementov podatkov in ki gredo na ploskve, ki prikazujejo podatke. Posamezni elementi vsebujejo vektorje parametrov in vrednosti. Spodaj so navedeni seznami virov, filtrov in slogov, ki so del običajne aplikacije SwiftVis. Druge lahko ustvarijo uporabniki, da izpolnijo bolj specifične potrebe. Uporabniki jih lahko pošljejo v glavni paket, tako da imajo drugi tudi dostop do njih. Glavno okolje SwiftVis je razdeljeno na dve regiji, tista, ki prikazuje graf povezanih virov, filtrov in ploskev ter drugo, ki prikazuje lastnosti elementa, izbranega v grafu. Naslednja seja v SwiftVis je prikazana spodaj z grafiko, ki se generira.

Prilagodljivost, ki jo zagotavlja zasnova SwiftVis, je pomembna, vendar lahko zaradi tega pride do učne krivulje. Iz tega razloga vam ponujamo nekaj osnovnih informacij in številne vaje, ki vas vodijo skozi korake, s katerimi se ukvarjate s SwiftVis.


Viri

Swift binarni podatki o položaju – Ta vir se bere v primarni izhodni datoteki podjetja Swift

Podatki o zavrženju Swift – ta vir se prikaže v podatkih o zavržku podjetja Swift

Podatki Swift dump – Ta vir bo prebral v različnih datotekah iz datoteke Swift, če je vse, kar morate analizirati, zadnji čas simulacije.

Podatki o Swift naletu – Ta vir se bere v podatkih o srečanju podjetja Swift

Splošne podatkovne datoteke – omogoča branje skoraj vseh besedilnih ali binarnih datotek.

Izvor SPH – vir za branje v binarnih podatkovnih datotekah SPH.

Zaporedja – Ta vir ne prebere datoteke, ampak namesto tega proizvaja linearno zaporedje vrednosti, ki jih je mogoče preiti skozi filtre, ne da bi prisilili uporabnike k ustvarjanju preprostih “lažnih” datotek.

Vir sheme – Ta vir vam omogoča, da napišete kodo SVScheme za branje podatkov iz datotek in jih naredite iz SwiftVis elementov. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Fixed 2D binned source – Ta vir v binarnih podatkovnih datotekah C sloga bere podatke, ki so že binned.

Virus delcev 2D – Ta izvor bere binarne podatkovne datoteke v slogu C za podatke, ki jih binarni delci namesto prostorske lokacije.

Košarica in Rad Vir – to bere binarno datoteko sloga C, ki vsebuje binarni odlagališče delcev in polmerov.


Filtri

Izbirni filter – ta filter izbere elemente prvega vira, ki temelji na določenih pogojih uporabnika.

Filter za redčenje – Ta filter je zasnovan tako, da naredi bolj enakomerno zmanjševanje podatkov. To vam lahko pomaga pri hitrem pregledu informacij brez obdelave vseh podatkov v viru.

Ključni izbirni filter – ta drugi izbirni filter, vendar je ta namen izbrati predmete iz ene datoteke na podlagi vrednosti v drugi datoteki.

Funkcijski filter – ta filter bo pretvoril podatke z uporabniškimi določenimi funkcijami. Lahko se uporablja tudi za združitev dveh vzporednih nizov podatkov v eno zbirko.

Konvertorski filter za pretvorbo – bo pretvoril iz orbitalnih elementov v heliocentrični in nazaj. Vključuje tudi konverzije za barientrične koordinate in koordinate vodilnega središča, ki se uporabljajo pri lokalnih simulacijah obroča.

Filter za spajanje – ta filter preprosto zajema dva ali več podatkovnih nizov in proizvaja in posamezen, ki je povezava obeh.

Masni filter – ta filter doda množice iz podatkovne datoteke planeta na elemente, ki se prebirajo iz vira binarnega položaja. Lahko dodaja elemente za osrednjo zvezdo.

SyMBA masni filter – ta filter bo dodal podatke o masi in združitvi v vir binarnega položaja.

Sortiraj filter – ta filter bo razvrščal vse elemente na podlagi določene formule ali vrednosti.

Binned filter – Ta filter bo ustvaril podatke, podobne histogramom, iz nabora podatkov v več dimenzijah.

Filtri filma – Ta filter omogoča prek okna podatkov iz vira. Ima funkcionalnost, tako da lahko preprosto premikate okno skozi podatke. To se lahko uporabi za prikaz, kako se sistem sčasoma razvija.

Sheme filter – Ta filter vam omogoča, da napišete kodo SVScheme, ki filtrira podatke. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Filter za številčenje skupine – To je predvsem, če vlečete v zunanjo zbirko podatkov, kjer so podatki v skupinah, vendar elementi skupin niso oštevilčeni. Skupine tudi štejejo same.

Wake vrh filter – Kot je mogoče uganiti iz imena, je bil ta filter namenjen za uporabo z planetarni obroč simulacijo podatkov, da potegne lokacije Wake peaks iz površinske ploskve. Najde lokalni maksimum vzdolž rezin skozi podatkovni niz, tako da se lahko uporabi z drugimi podatki, da bi našli stvari, kot so točke največje ekscentričnosti za delce.

Filter za izbiro regije (Poslušalec) – Ta filter izbere pravokotno območje tako, da sprejme samo elemente, ki v določenem obsegu spadajo v dve dimenziji. Prav tako je poslušalec, zato ga lahko nastavite tako, da kliknete vnos iz ploskev in premaknete regijo za ogled ali ustrezno povečate.

Filter za izbiro rezin (poslušalec) – ta filter izbere elemente na določeni razdalji okoli rezine skozi podatkovni niz. Rezine so narejene v 2-D prostoru bodisi navpično, vodoravno ali vzdolž poljubnega segmenta. Podatki so izboljšani z razdaljo in položajem vzdolž rezine. To je poslušalec, tako da lahko najdete rezine s klikom na ploskve.

Rotacijski filter (Poslušalnik) – Ta filter vam omogoča, da spremenite podatke z vrtenjem ali drugimi transformacijami. Za olajšanje uporabe je potreben vnos kot poslušalec.

Urejevalnik elementov elementov – Omogoča preglednico kot sposobnost hitrih opravil.

Count Rebin Filter – s tem boste ponovno združili podatke vzdolž skupin. Določite, koliko podatkov naj se prenese v vsakega od novih zabojnikov.

Linearni Fit Filter – Ali linearno ustreza podatkom. To dejansko doda v dva filtra. Tisti, ki oddaja parametre fit in drugi, ki oddaja ustrezne vrednosti.


Ponori

Slušalec za pomivalno statistiko – ta ponor bo prikazal statistične podatke o vhodih, ki jih vsebuje, vključno z min, max in std za vsak parameter in vrednost. Prav tako je poslušalec in bo zabeležil lokacijo klikov v besedilnem območju, iz katerega je mogoče kopirati.


Plotiranje

Element ploskve – to je element, ki ga postavite v graf. Ima veliko lastnih možnosti poleg tega, da lahko prikaže več različnih slogov.

Plaster plot – To je standardni slog oblikovanja, ki je določen v splošnem 2-D SwiftVis načrtovanju mehanizma.

Pravokotna površina – to je za osnovne površine. Namenjen je uporabi s filtrom za bin.

Orbitska parcela – s tem bo potegnjena orbita teles. Predpostavlja, da je vnos v orbitalnih elementih datoteke Swift.

Vektivno polje – Ta slog pozicije posname in jih odpre, da prikaže vektorska polja.

Shema sheme – to je slog ploskve, ki vam omogoča, da napišete SVScheme kodo, ki bo za vas naredila custom cropping. Glejte Uporaba SVScheme za podrobnosti o uporabi.

Image adder – Ta slog ploskve bo v ploskev dodal skalirano sliko. To je priročen način, da dodate zunanjo grafiko v ploskev ali celo samo, da postavite osi na slike, ustvarjene z drugimi orodji.

Streamlines – Ta slog plesa je bil razvit za nekaj dela v dinamiki obroča. V bistvu povezuje točke v nizu podatkov. To vedenje je lahko podrejeno s filtrom za številčenje skupin in razpršenim grafom.

Splošna površina – To je bilo razvito tudi za dinamiko obroča, ampak služi tudi kot močnejša oblika površinskega plotterja. Medtem ko se lahko uporablja s filtriranim filtrom na enak način kot pravokotna površina, ima sposobnost, da površine na površini naredijo neresnične in lahko na eni površini zasidra do tri nabora podatkov.

Iso Line Surface – s črtami stalne vrednosti čez površino. Lahko se prekrivajo na pravokotni površini, na splošno površino ali pa samo vlečeni sami.


Javadocs

Vir: http://www.cs.trinity.edu/~mlewis/SwiftVis/

 

Vizualizacija podobnosti človeške in šimpanzne DNA

Eamonn Keogh, Stefano Lonardi, Victor B. Zordan, Sang-Hee Lee in Manel Jara.

Univerza v Kaliforniji – Riverside
Riverside, CA 92521

Nedavna objava popolnega genoma šimpanza, ki jo zaznamuje praznična številka revije Nature, nam pove, da imajo ljudje in šimpanzi 96 odstotkov istega genskega materiala. Ta številka je težko razumeti, kaj natančno pomeni, da imamo 96% naše DNK z najbližjimi bratranci v življenju?

Neposredna preiskava DNK samega sebe ne pomaga. Na primer, razmislite o prvih 100 baznih parov šimpanskih mitohondrijskih DNA:

  • gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcaccccataaacaaacaggtttggtcctagcctttctattag …

in prvih 100 baznih parov humane mitohondrijske DNA:

  • gatcacaggtctatcacctattaaccactcacgggagctctccatgcatttggtattttcgtctggggggtgtgcacgcgatagcattgcgagacgctg …

Zelo težko je izmeriti podobnost, poln genoma za ljudi in šimpanz pa je dejansko približno 3 milijarde baznih parov!

Izdelali smo preprosto orodje, ki ljudem omogoča vizualizacijo in razumevanje podobnosti / neskladnosti zaporedij DNA. Čeprav je to delo trenutno neobjavljeno in še vedno poteka, smo izdali videoposnetek, ki se nanaša na človeško in šimpansko DNK, ki sovpada z objavo celotnega genomskega šimpanza.

Videoposnetek je približno 2 minuti dolg in popolnoma samodejen. Spodaj je različica Youtube, morda si boste raje ogledali mnogo samostojnejših različic večje ločljivosti spodaj.

  • Googlova video različica je tukaj.
  • Igrajte različice Quicktime v brskalniku: Opozorilo, najboljša kakovost, vendar velika datoteka. Pred predvajanjem videoposnetka lahko traja nekaj minut.
  • Igrajte različico AVI v brskalniku.
  • Igrajte različico MP4 v brskalniku.
  • Desni klik za prenos različice Quicktime: Opozorilo, velika datoteka (prost igralec).
  • Desni klik za prenos različice AVI
  • Desni klik za prenos različice MP4

 

Kratek bios udeležencev:

  • Dr. Eamonn Keogh je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo podatkovno rudarjenje in vizualizacijo.
  • Dr. Stefano Lonardi je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo računalniško molekularno biologijo.
  • Dr. Victor B. Zordan je docent za računalništvo na UCR. Njegovi raziskovalni interesi vključujejo računalniško grafiko.
  • Dr. Sang-Hee Lee je asistent profesor antropologije pri UCR. Njeni raziskovalni interesi vključujejo človeški razvoj in taksonomijo.
  • Manel Jara je študent računalništva na avtonomni univerzi v Barceloni in leta 2005 obiskoval študent na UCR.

 

Če želite omeniti to delo, prosimo, uporabite:

E. Keogh, S. Lonardi, V. B. Zordan, S.H. Lee in M. Jara (2005). Vizualizacija podobnosti človeške in šimpanzne DNA. (Multimedijski video). http://www.cs.ucr.edu/~eamonn/DNA/

Hvala za pomoč in predloge Colin Crenshaw, Bill Yuan-chi Chiu in Anwar Adi. Glasba v videoposnetku je Chopin – Ballade No. 4 in f minor, Op.52, Andante con moto, ki ga je izvajal dr. Sang-Hee Lee.

 

Vir: http://www.cs.ucr.edu/~eamonn/DNA/

Kontrolni seznam za dobro programiranje

Ta kontrolni seznam vam bo pomagal napisati visoko kakovostne programe.
Raphael Finkel, 17. 8. 2005

  • Identifikatorji: poskrbite, da so vsi vaši identifikatorji smiselni.
    1. Identifikatorji z enim črkami skoraj nikoli niso pomembni.
    2. Imena, kot sta zastava in temp, so redko pomembna. Namesto zastave razmislite o poimenovanju Boolovega stanja, ki ga preveri, na primer valueFound.
    3. Razmislite o več besednih identifikatorjih, na primer nameIndex. Dolgi identifikatorji (znotraj razloga) so ponavadi zelo berljivi.

 

  • Neomejeni literali: Izogibajte se številkam razen 0 in 1 in nizov, razen “” v vašem programu, razen če določite konstante.
    1. Ne uporabljajte dobesednega integerja kot vezane matrike.
    2. Ne uporabljajte dobesednega integerja kot parameter za zagon, kot je časovna omejitev ali številka vrat.
    3. Ne uporabljajte dobesednih celih števil, da bi izbrali vnose v meniju.
    4. Za merjenje velikosti niza ali nekaterih podatkov ne uporabljajte dobesednega celega števila; uporabite sizeof () in strlen () v C in C ++ ter .length () in .size v Java.
    5. Ne uporabljajte dobesednega niza za ime datoteke. Čeprav lahko ustvarite dobesedne nize.
    6. Ne uporabljajte dobesednega integerja, da bi indeksirali niz, ki vsebuje heterogene podatke.
    7. Ne razglasi identifikatorja z imenom, ki označuje dobesedno, na primer “trideset”.

 

  • Modularizacija: program je zgrajen iz interaktivnih komponent.
    1. Vse svoje kode ne postavljajte v glavno () rutino.
    2. Pravzaprav ne naredite nobene rutine preveč dela. Če je več kot 50 vrstic, je morda predolgo.
    3. Če večkrat podvojite kodo, preberite, ali bi zanka delovala bolje ali morda podprogram.
    4. Če ugotovite, da ste zelo globoko vdolženi, verjetno ne uporabljate podprogramov, ko bi morali.
    5. Ne preoblikujte knjižničnih rutin (razen če vaša naloga to zahteva). V priročnikih si oglejte sprintf () in atoi (), na primer.
    6. Uporabite datoteke glave v C in C + + (datoteke glave imajo imena, ki se končajo .h), da določite vse konstante, ki jih potrebujejo več datotek, in razglasi vse podprograme, ki se izvažajo med datotekami. Ampak v glave datotek ne dajte telesa podprogramov (z redko izjemo inline podprogramov).

 

  • Oblikovanje: program mora biti enostaven za branje.
    1. Oglejte si http://geosoft.no/development/javastyle.html za jasne predloge o oblikovanju in drugih predstavitvenih težavah. Ta sklic je posebej usmerjen v Java, vendar ima tudi vrednost za druge jezike.
    2. Poskusite omejiti vse vaše črte na 80 znakov; mnogi ljudje vidijo kodo v okencih 80 stolpcev zaradi zgodovinskih razlogov.
    3. Ne uporabljajte zavihkov in presledkov za vnos, saj vsi zavihki besedila ne ravnajo z zavihki kot natanko 8 presledkov.
    4. Ali sledite doslednemu uvajalskemu vzorcu, ki odraža kontrolno strukturo programa.
    5. Ne postavljajte veliko praznih vrstic v svoj program. Ena prazna črta med podprogrami je dovolj.
    6. Različni operacijski sistemi končajo linije na različne načine. Če se premikate med Win32 (ki uporablja \ r \ n), Unix (ki uporablja \ n) in MacOS (ki uporablja \ r), spremenite svojo datoteko, da uporabite dosledno metodo zaključevanja.
    7. Izredni bit (Unix) ne nastavite na izvorne datoteke.

 

  • Kodiranje: želite, da je kodiranje jasno, vzdržljivo in učinkovito, v tem vrstnem redu. Nekatera pravila tukaj so zelo specifična; drugi so bolj splošni.
    1. Ne uporabljajte zaporedja, če izjave, ki nimajo drugega, če se lahko ujema samo ena oseba; uporabite drugo, če.
    2. Če želite kategorizirati vnos besedila, ne navedite možnih prvih znakov.
    3. Uporabite izmenjevalce namesto množenja za izdelavo vzorcev bitov.
    4. V izjavi o stikih vedno preverite privzeti primer. Podobno tudi v zaporedju izjav if-then-else uporabite drugo.
    5. Vsi sistemski klici so lahko neuspešni. Vedno preverite povratno kodo in uporabite perror (), da prijavite napako.
    6. Boolovi morajo vedno uporabljati logično vrsto v Java, bool v C ++ in 0/1 celo število v C. Ne uporabljajte znakov t in f in ne uporabljajte -1 in 1.
    7. Uporabite zanke za inicializacijo podatkovnih struktur, če je to mogoče.
    8. Vsako spremenljivko in vsako polje strukture uporabite za točno en namen. Ne preobremenite jih, razen če obstajajo odlični razlogi za to.
    9. Ne uporabljajte istega identifikatorja za vrsto, spremenljivko in ime datoteke, tudi če spremenite velikost. Preveč je zmedeno.
    10. Če spremenite podatke s htonl () ali podobno rutino pred prenosom omrežja, ne spremenite podatkov na mestu. Zgradite drugo podatkovno strukturo.
    11. Ne uporabljajte globalnih ali nelokalnih spremenljivk. Vsako spremenljivko označite v najmanjšem možnem obsegu. Obstaja legitimna uporaba nelokalnih spremenljivk, vendar se prepričajte, da jih res potrebujete.
    12. Programi Shell, Perl in Python morajo imeti svoje #! vrstico kot prva vrstica datoteke; sicer je vrstica le komentar.
    13. Poskusite se izogniti kodiranju posebnih primerov. Pogosto lahko uporabljate psevdodatne ali druge metode podatkovne strukture, ki vam omogočajo, da v redne primere zložite posebne primere.

 

  • Prevajalniki: Naj vam pomagajo najti napake
    1. Vedno vpišite prevajalce z vsemi opozorili. Za C in C + +, uporabite oznako -Wall. Za Java uporabite -Xlint: all -deprecation in uporabite program pmd, da bi dobili predloge za boljši slog. Za Python uporabite -t-W all.
    2. Vsi programi Perl bi morali delovati z oznako -w in bi morali uporabljati strogo. Vsi Perl cgi-bin skripte bi morali imeti tudi oznako -T.

 

  • Uporabite pripomoček: uporabite ga in ga dobro uporabite.
    1. Makefile mora vedno imeti “čist” recept, ki bi moral odstraniti vse datoteke, ki jih lahko rekonstruirajo drugi recepti v makefilu, vključno z objektnimi in izvedljivimi datotekami.
    2. Če vaš projekt vsebuje več izvornih datotek, mora makefile ustvariti datoteke (.o) predmeta po potrebi in jih povezati skupaj.
    3. Makefile je treba zapisati tako, da če se zaženete naredite dvakrat zaporedoma, drugi poganjki ne znova preračunajo.
    4. Vsak recept mora ustvariti datoteko, določeno v svojem cilju.
    5. Vsak recept mora uporabiti vsako datoteko, navedeno na njenem predpogojnem seznamu.
    6. Naučite se uporabljati pravila za cilje, kot je .c.o, da bi se izognili ponavljajočim makefilom.
    7. Če imate samo eno izvorno datoteko C ali C ++, mora imeti izvršljiva datoteka isto ime (brez razširitve .c ali .cpp).
    8. Poskrbite, da boste vse datoteke .h navedli kot predpogoje, če so ti potrebni. Razmislite o uporabi makedependa, da ustvarite seznam predpogojev za vas.

 

  • Dokumentacija: Ne gre le za grederja. Pomaga vam, ko napišete program!
    1. Dodajte dokumentacijo med pisanjem programa. Vedno ga lahko spreminjate, ko spremenite načrt.
    2. Vključi zunanjo dokumentacijo: Kako program komunicira in zažene, in kaj naj bi storil? Zunanja dokumentacija je lahko v ločeni datoteki; za majhne projekte, je lahko komentar v datoteki z enim samim virom.
    3. Vključi interno dokumentacijo: Kateri algoritmi in podatkovne strukture uporabljate? Pregled je lahko v ločeni datoteki, običajno pa je interna dokumentacija postavljena na specifične rutine, deklaracije in korake, ki jih opisuje.
    4. Preverite celoten program in dokumentacijo za črkovanje napak. Neprimerno je, da spremenite napačno črkovano delo, in ne bo več pozornosti na podrobnosti.
    5. Preverite vse dokumente (in izhodna sporočila) za slovnične napake.
    6. Programi so precej bolj berljivi, če kratek komentar o zapiralju. Na primer, zapiranje zaprtega pogojnega lahko vsebuje komentar, kot je “če vrednost izgleda dobro”. Zapiralo, ki zapira zanko, ima lahko komentar, kot je “za vsako vhodno linijo”. Zapiralo, ki zaključuje postopek, ima lahko komentar, ki ga imenujemo postopek.  Zapiralo, ki zapira razred, ima lahko komentar, ki pravi »razred« in nato ime razreda.

 

Tu lahko najdete izvirno objavo v angleščini: http://www.cs.uky.edu/~raphael/checklist.html

Analiza razpoložljivih tehnik merjenja pasovne širine

Raziskave | Pretekli raziskovalni projekti | Prototipi

Uvod

Ker se internet razvija, hitrost povezav postaja hitrejša in preko nje se prenašajo velike količine podatkov. Zaradi tega je treba poznati rezervne ali neizkoriščene zmogljivosti poti postati ključnega pomena za pravilno uporabo omrežnih virov. V tem scenariju je predvideno, da lahko več aplikacij koristi od poznavanja razpoložljive pasovne širine (AB). Na primer:

  • Transportni protokoli lahko uporabljajo znanje, da hitro dosežejo največ neizkoriščene zmogljivosti.
  • Omrežja “peer-to-peer” in “overlay” lahko uporabijo znanje AB, da izberejo boljše poti
  • Znanje AB se lahko uporablja za izbiro strežnika / vira.

Številna orodja so bila zasnovana za merjenje AB. Nekateri so Pathload, Pathchirp, Abing, Smreka, IGI / PTR, Cprobe, netest in Iperf. Vsa ta orodja delujejo z vbrizgavanjem “sonda sonde” v pot od konca do konca. Ker “sonda sonde” stori z navzkrižnim prometom na poti, se razburja. Sprejemnik nato analizira te motnje, da bi zaključil AB poti. Ta del orodja se imenuje “logika sklepanja”. Prav tako je bilo zasnovano nekaj aplikacij, ki uporabljajo znanje AB, na primer SOBAS.

Vendar pa je na področju ocene AB veliko pomanjkljivosti, ki smo jih razvrstili na tri področja.

  • Evalvacija orodja: Večino orodij spremlja ocena. Vendar
    • Ni celovite ocene vseh orodij v skupnem okolju.
    • Večina ocen je bila omejena na poti 100Mbps ali manj.

Naš cilj pri ocenjevanju orodij je dvakrat. Najprej ocenite orodja kot črna polja pod enakimi preskusnimi pogoji in razložite razlike med uspešnostjo orodij. Drugič, ovrednotimo orodje algoritmov, neodvisno od kakršnih koli sistemskih učinkov ali pristranskosti, da ocenimo metodologijo, ki lahko najbolje oceni AB. To je zato, ker so nekatera orodja omejena pri njihovih izvedbah zaradi sistemskih omejitev.

  • Časovni vidiki AB: Trenutno ni na voljo orodja AB, ki upošteva časovni vidik ocene AB. Identificiramo tri časovne količine: (i) merilno časovno skalo ali dolžino toka, ki se uporablja za sondiranje AB, (ii) intenzivnost vzorčenja ali število sond, uporabljenih za sklepanje AB, (iii) Čas delovanja orodja je čas, po katerem orodje vrne meritev. Študijo vpliv teh treh količin na točnost, variabilnost in stabilnost AB.
  • Aplikacije ki uporabljajo znanje AB: Veliko dela je bilo namenjenih oblikovanju orodij, ki lahko merijo AB. Vendar je trenutno edini kraj, kjer se uporablja znanje o AB, v aplikacijah za nadzor omrežja. Tudi tukaj operaterji raje uporabljajo splošna orodja, kot je “iperf” za merjenje AB. Naš cilj je preučiti vrednost dodajanja znanja AB za nekatere tipične internetne aplikacije in preučiti zahteve aplikacij za poznavanje AB. Nekatere aplikacije, ki jih predlagamo, so: Bulk-Transfer, Pretočni protokoli, Prekrivna usmeritev in izbira virov.

 

Metodologija

  • Ovrednotenje orodja: Za ovrednotenje orodij in oblikovalskih komponent uporabljamo kombinacijo (i) poskusov v laboratorijskem preskusnem ležišču, (ii) poskusih na instrumentiranih internetnih poteh in (iii) simulacij z uporabo ns-2. Za našo črno-box oceno orodja smo uporabili laboratorijsko testno posteljo in instrumentirane poti in pridobili nekaj začetnih vpogledov v delovanje nekaterih AB orodij. Nato smo uporabili simulacije ns-2, da bi ocenili učinkovitost različnih zobnih in sklepnih mehanizmov orodij AB.
  • Časovni vidiki AB: En pristop za ovrednotenje učinkov časovnih parametrov na AB je uporaba orodja, ki lahko popolnoma izmeri AB poti. Če imamo takšno orodje, lahko spremenimo različne časovne parametre in preučimo učinek, ki ga ima na AB. Vendar takega orodja ne obstaja, zato ta pristop ni izvedljiv. Drug pristop je, da se upoštevajo sledovi ravni povezave in izračuna AB od teh sledi. Ta metoda nam daje tudi popolno znanje o procesu AB. To tehniko uporabljamo za preučevanje vpliva časovnih veličin, kot so časovna meritev časa merjenja, intenzivnost vzorčenja in potek trajanja orodja za ocene točnosti, spremenljivosti in stabilnosti AB.

 

Publikacije

  • Empirična študija o ocenjevanju tehnik za merjenje razpoložljive pasovne širine, Infocom 2007 (pdf)
  • Empirična študija vpliva vzorčnega časovnega razporeda in strategij na merjenje razpoložljive pasovne širine, PAM 06 (pdf)
  • Primerjava orodij za ocenjevanje širokopasovne širokopasovne povezave na hitrih povezavah, PAM 05 (pdf)
  • Prepoznavanje povezav z ovirami z uporabo porazdeljenih končnih do končnih razpoložljivih pasovnih širin, BEst’03 (doc)

 

Sodelavci

Margaret Murray (TACC)

KC Claffy (CAIDA)

Marina Fomenkov (CAIDA)

Andre Broido (CAIDA trenutno na GOOGLE)

 

Druge povezave

Okolje laboratorija Schooner
Emulab eksperimentalno okolje

 

Orodja

Pot

Pathchirp

Smreka

Abing

IGI / PTR

IPERF

 

Aplikacije

SOBAS: Samodejna velikost socket Buffer

AB v Overlay Networks

Ocena velike skale AB

 

KODA

 

To je koda, ki smo jo uporabili v študiji INFOCOM 2007. (.tar.gz)

Nekaj točk o tej kodi:

1) Razširite kodo v ns- <število različic> (uporabite ukaz “tar -zxvf <filename>”) vaše namestitve ns. Vse datoteke morajo dati na ustrezna mesta.
Beseda previdnosti bo ta preklic prepisala datoteko ./tcl/lib/ns-default.tcl, ./tcl/lib/ns-packet.tcl in ./common/packet.h in makefile.in. Vrnite te datoteke nazaj, če imate spremembe, ki jih ne želite izgubiti ali jih lahko dodate v stvari ročno, tako da pogledate vsebino datoteke ../* Poiščite niz Alok, če želite izvedeti, kaj sem spremenil * /

2) koda orodja je prisotna v imeniku. / bwtools /

3) skripti NS-Basic so nekateri osnovni skripti .tcl, ki vam pomagajo ugotoviti, kako se sklicujejo na orodja.

4) Končno sem to kodo zgradil na ns-2.29, in nisem prepričan, kako dobro bodo te spremembe zadržale v zaporednih različicah ali izpustih ns.

Če imate kakšna druga vprašanja, mi sporočite in storil bom, kar lahko, da vam pomagam.

Drugi viri:

  • Skupina vzorčnih skriptov, ki se sklicujejo na različna orodja. (. tar.gz)
  • Vzorec skripta za izvajanje tcp-replay (. Tcl)
  • Skript perl za pretvorbo sledi ascii v format ponovitve sledi NS (.pl). Ta scenarij je spremenjen iz prvotnega scenarija, ki ga je napisal Pentikousis Kostas (http://ipv6.willab.fi/kostas/)
  • Sledi, ki smo jih uporabili za študij v binarnem formatu ponovitve sledi NS (.tar.gz) (previdnost velika datoteka 250 Mb)

 

Izvirni članek: http://www.cs.unc.edu/~jasleen/Research-analysisof.htm

Pregled vzorčnih jezikov načrtovanja programov

Pregled vzorčnih jezikov načrtovanja programov

ki sta jih uredila James O. Coplien in Douglas C. Schmidt
Addison Wesley, 1995, 562 strani

Pregledal:
Eugene Wallingford
Oddelek za računalništvo
Univerza Severne Iowe
Cedar Falls, Iowa 50614-0507
wallingf@cs.uni.edu


V zadnjih petih letih se je pojavila živahna skupnost raziskovalcev in strokovnih delavcev okoli ideje vzorcev. Prvotno raziskoval arhitekt Christopher Alexander, vzorci in vzorčni jeziki zajemajo skupno modrost o dobrem dizajnu in ga predstavijo v literarni obliki, ki drugim omogoča, da ponovno uporabijo to izkušnjo. Vsak vzorec obravnava določen problem oblikovanja v določenem kontekstu, obravnava sile, ki otežujejo iskanje dobre rešitve, in predstavlja rešitev, za katero je bilo ugotovljeno, da je uspešna pri posredovanju teh sil. Nič o vzorcih ni povsem objektivno usmerjeno, vendar velika večina dela v skupini vzorcev vključuje analizo in oblikovanje OO.

S to knjigo uredniki Jim Coplien in Doug Schmidt predstavljajo svet na splošno različnim vzorcem skupnosti. Poglavja vzorčnih jezikov programskega oblikovanja temeljijo na dokumentih, predstavljenih na prvi letni konferenci vzorčnih jezikov programov, ki je potekal avgusta 1994. To je bila nova vrsta konference, kjer ljudje niso predstavljali novih raziskav, temveč “starih” rešitev, ki so jih večkrat uporabili v lastnih programskih praksah. Osrednja značilnost PLoP je bila uporaba pisateljske delavnice namesto tradicionalnih predstavitev papirja. Na delavnicah so pisci poslušali majhno skupino recenzentov, ki so se pogovarjali o svojih dokumentih, njihovih idejah in učinkovitosti njihove oblike. Kot rezultat, Coplien in Schmidt trdita, da so poglavja v tej knjigi zagotovo med najbolj intenzivno urejena dela v sodobni programski literaturi. To ni prazninski zahtevek; vsako poglavje knjige je informativno, dobro napisano in prijetno branje.

Oddelki 1, 5 in 7 predstavljajo vzorce, ki so večinoma splošni za pojem objektno usmerjenega razvoja programske opreme. V prvem poglavju se štiri poglavja nanašajo na uporabo vzorcev pri razvoju okvirov in komponent, ki jih je mogoče ponovno uporabiti. Ta poglavja kažejo tudi veliko širino vzorčne literature. Poglavje 2 z Riehle in Zullighoven opisuje vzorec jezik za oblikovanje okvirov z vidika orodij in materialov. Ekstrapolirajo iz zanimive metaforke v niz modelov, ki predstavljajo vpogled v zasnovo večine vseh aplikacijskih okvirov. Po drugi strani pa poglavje 1, ki ga je predstavil Adams, predstavlja samo en vzorec <Funkcionalnost Ala Carte <na samo dveh straneh. Ta vzorec obravnava težavno vprašanje, kako razširiti zmogljivosti okvira, ne da bi privedli do neželenih kompromisov v uspešnosti.

Poglavja v 5. razdelku se poglabljajo v vprašanje klasifikacije vzorcev. Dva od teh poglavij se osredotočata na različne dimenzije, na podlagi katerih se lahko organizirajo vzorci, tako da lahko oblikovalci programske opreme prepoznajo ustrezne vzorce v pravem trenutku. Poglavje, ki sem ga zanimalo najbolj zanimivo, je bil katalog Robertovih vzorcev vzorcev, ki jih je našel v velikem številu obstoječih kod. Martinovi vzorci praktično obravnavajo vrste odločitev razvijalcev v vseh velikih programskih projektih. Končno, 7. poglavje vključuje vzorce pri oblikovanju posameznih predmetov. ki spodbujajo ponovno uporabo. Dve od teh poglavij so med najboljšimi v knjigi. Opis Viljamaa vzorca Client-Specified Self v poglavju 26 jasno razlaga rešitev problema prenosa odgovornosti v kontekstih, kjer se lahko vloga, ki jo ima predmet, dinamično spremeni. V poglavju 27 Auer daje vzorčni jezik za oblikovanje objektov, ki uporabljajo samokapacilo. Ta tehnika privede do objektov, ki se v okviru prihodnjih podrazredov maksimalno ponovno uporabijo. To poglavje je tako dobro in obravnava tako pomemben problem, da bi bilo treba branje za vse objektno usmerjene programerje.

Oddelki 2, 6 in 8 se nanašajo na vzorce porazdeljenih računalnikov. Bogastvo te domene je vodilo k bogatenju dela v skupini vzorcev o vprašanjih sinhronizacije, vzporednosti, integracije aplikacij in obravnave dogodkov. Poglavja v teh oddelkih predstavljajo vzorce, ki zanimajo tudi oblikovalci, ki ne delujejo na tem področju, od katerih je ta pregledovalec eden. Njihova vrednost izhaja iz vrednosti vzorca, ki spodbuja razpravljanje o problemih in rešitvah na ravni, ki naredi zanimive oblikovne odločitve eksplicitne in jasne. Mnoge od teh odločitev se pojavljajo, čeprav v nekoliko drugačnih oblikah, v drugih vrstah sistemov, zato vzorci zagotavljajo obliko navdiha, ki morda drugače ni na voljo. Med bolj splošno dostopnimi poglavji v teh oddelkih so razprave Meszaros o vzorcu Half-Object Plus protokola za razgradnjo posameznega predmeta na več gostiteljih na način, ki je pregleden za uporabnike, in Schmidtov reaktorski vzorec za prepoznavanje in pošiljanje večje obravnave dogodkov v dogodek usmerjen sistem.

Oddelek 3 je edini oddelek, ki je specifičen za določeno domeno, to je poslovanje. Kot oseba z izkušnjami, ki gradijo modele poslovnih procesov in strokovnega znanja, sem ugotovila, da je to tanko poglavje treh poglavij izredno zanimivo. Ta poglavja ponovno prikazujejo veliko širino vzorčne literature. Poglavje 11, ki ga pripravi Wake, prikazuje posamezen vzorec za predmete številke računa. Njegova kratka razprava o vprašanjih, na katerih temeljijo specifikacije, ustvarjanje in uporaba teh objektov, je lucidna in polna pomembnih točk. V poglavju 10 Cunningham obravnava temo navidezne preprostosti <preverjanje podatkov v vstopnih sistemih <in obvlada razumljiv jezik enajstih vzorcev, ki zajame temeljno strokovno znanje za ohranjanje celovitosti informacij v raznolikem programskem sistemu.

Oddelek 4 razširi temo oblikovanja programov v naslov knjige v najširšem pomenu, procesu in organizaciji razvoja programske opreme. Vsako od štirih poglavij v tem poglavju bo veliko zanimanje za vsakogar, ki se ukvarja z gradnjo velikih programskih sistemov. V poglavju 13 Copliena je opisan jezik štiridesetih vzorcev za generativni razvoj kakovostne programske opreme, ki temelji na obsežni študiji uspešnih programskih projektov. Ti vzorci pokrivajo celotno paleto dejavnosti velikosti organizacije, da nadomestijo uspeh. Poglavje 14, ki so ga predstavili Foote in Opdyke, predstavlja vzorce, ki obravnavajo vprašanja evolucije v objektnih sistemih in kako lahko oblikovalci olajšajo naravni tok iz prototipa z razširitvijo odgovornosti na konsolidacijo zrelega predmeta v dostavljenem sistemu. Whitenack opisuje začetek vzorčnega jezika za analizo zahtev v poglavju 15. Končno, v poglavju 16, Kerth poroča o vzorčnem jeziku, katerega cilj je “čiščenje” analize faze razvoja programske opreme. Njegova trditev je, da so bili pred oblikovanjem takih vzorčnih jezikov proces analize in oblikovanja tako težko opisati, da so se razmišljanja o načrtovanju (kot so kategorije objektov) v analizi mešale.

Glede knjige kot celote je skupno osem oddelkov, ki so v večini zbirk konferenčnih dokumentov občasni. Tema vzorca je še vedno sveža v skupnosti, avtorji vseh tridesetih poglavij pa so napisali o vzorcih na način, ki zagotavlja presenetljivo enotnost v knjigi. Na žalost se ta enotnost manifestira tudi v precejšnji odvečnosti v poglavjih in v bibliografijah. Narativni opisi Alexanderovih vzorcev in navdiha do programske skupnosti dejansko dajejo dober občutek domačnosti v postopkih, vendar ponavljajoči se bibliografski zapisi naredijo naslednje citate v papirnicah težko nalogo. Eden stranski učinek je, da je mogoče dokumente prebrati sorazmerno neodvisno drug od drugega, čeprav bi predlagal veliko branje knjige, da bi lahko dobil celoten učinek vzorcev, ki jih ponujajo.

Novost polja tudi pomeni, da mnogi avtorji opisujejo vzorce, ki so zelo podobni drugim, opisanim drugje v besedilu. Naloga, ki ostaja za vzorčno skupnost, je integracija različnih, vendar podobnih vzorčnih jezikov v skladne celote. Toda ta naloga ne bo enostavna, saj se v poglavju 16 razpravlja o Kerthu. Nazadnje, knjiga kaže dobro ravnovesje vzorcev, ki niso jezikovno osredotočeni, vendar se pogosto poročajo v kontekstu enega samega jezika (običajno Smalltalk ali C + + ).

Coplien in Schmidt sta sestavila zelo berljivo in informativno raziskavo dela, ki se opravlja na vzorcih za načrtovanje programske opreme. Priznavajo v svojem predgovoru, da je širok spekter problemov in rešitev, predstavljenih v tem prvem delu, zahteval bralca in da zato vsa poglavja ne bodo enako zanimiva za vsakega bralca. S tem ocenjevanjem se strinjam, vendar se strinjam tudi s svojo spodbudo, da se udeležim vseh osem poglavij. Po skeniranju skozi knjigo prvič, moj um je tekel z idejami, ki so jih posadili ali prebudili različni dokumenti v knjigi. Te zamisli so zahtevale moje drugo branje, v katerem sem lahko precej globlje razumel pomen nekaterih poglavij. In če imate le omejen čas, vas prosimo, da preberete poglavje 4 o procesu in organizaciji. Ponazarja vzorčni pristop, zajame duh proučevanja procesa za artefaktom in je primeren za bralce vseh okolij. Po branju, boste skoraj zagotovo želeli iti nazaj za več.

Uvod v MathXpert

MathXpert svojim uporabnikom omogoča reševanje matematičnih problemov in izdelavo grafov. Pri reševanju problema omogoča uporabniku, da gradi rešitev po korakih, namesto da samo izdeluje enolični odgovor. Vsak korak se opravi z uporabo nekega matematičnega delovanja v prejšnji vrstici in je podan z njegovo utemeljitvijo. Uporabnik ustvari novo črto z miško, da bi izbral del trenutne vrstice za spremembo. Nato se prikaže meni operacij in uporabnik izbere operacijo, ki jo želite uporabiti. Računalnik opravlja težko dejansko uporabo operacije. Zato ne morete narediti “zdrsa”, kot je spustiti znak minus. Prav tako ste zaščiteni pred logičnimi napakami, na primer z delitvijo z ničlo in s konceptualnimi napakami, kot je uporaba napačnega zakona, kot je ln (a + b) = ln a + ln b. Takega nepravilnega zakona ni mogoče najti v meniju, zato ga ne morete uporabiti. Ko ste končali s težavo, jo lahko natisnete in vklopite za domačo nalogo.

MathXpert ne samo, da ima sposobnost samostojnega izvajanja posameznih korakov, ampak vsebuje tudi prefinjen nabor pravil, ki mu omogočajo, da reši skoraj vse težave z učbenikom v omenjenih predmetih. Uporablja to sposobnost, da pomaga študentu, ki ne ve, kaj storiti. Po potrebi lahko študent pripravi celovito rešitev po korakih. Ponuja nekaj manj ekstremnih možnosti: obstaja gumb Namig in obstaja gumb AutoStep, ki bo za vas naredil en korak; obstaja tudi gumb ShowStep, ki bo predlagal izbiro katerega izraza se bo spremenil.

MathXpert razlikuje od programske opreme, kot so Maple in Mathematica v teh glavnih pogledih:

  • Ustvarja postopne rešitve z uporabo operacij, ki jih učijo učenci
  • Ne bo dovoljevala logične napake
  • V celoti ga nadzirajo miške, meniji in gumbi. Čas, potreben za učinkovito uporabo, je približno pet minut.

MathXpert lahko naredi veliko različnih grafov. Obstaja več funkcij, ki ločujejo MathXpert grapher iz drugih grafikonov:

  • Grafi pravilno oblikujejo, četudi ima funkcija singularnosti. Drugi grafi nepravilno vstavljajo nepravilne navpične črte ali grafične asimptotične dele.
  • Omogoča vam, da hitro pripravite niz grafov tako, da spremenite vrednost parametra v formuli, ne da bi morali urediti formulo.
  • Lahko grafično funkcijo. Na primer, lahko delne vsote Fourierjevih vrstic grafiramo s številom izrazov kot parametrom.

V tem primeru si lahko ogledate, kako napačen je bil slaven matematik Leonhard Euler leta 1753, ko je zavrnil trditev Bernoullija, da je vsaka funkcija lahko zapisana kot vsota trigonometrične serije. Euler je menil, da je, ker so trigonometrične funkcije neprekinjene, vsota niza mora biti tudi neprekinjena. Če bi imel MathXpert, ne bi naredil te napake – jasno lahko vidite, da se prekinitev povečuje s povečanjem števila izrazov, in lahko jasno vidite, kaj fiziki imenujejo “Gibbsov fenomen” nihanja blizu razkoraka . Kot je bilo, je vpliv Eulerja nazadoval razvoj Fourierove serije petdeset let. Fourier se je moral izvleči v Francosko akademijo, preden je lahko objavil svoje temeljno delo leta 1807. Ampak jaz odpeljem …

MathXpert trži podjetje Pomoč pri matematiki.. Na tej spletni strani najdete več informacij o MathXpert-u, vključno z opisom, kako jo uporabljati, skupaj z vzorčnimi zasloni.

Če želite prebrati moje dokumente o MathXpert, priporočam [37] kot kraj za začetek.

Eno od načel, na katerih temelji MathXpert, je načelo pravilnosti. To pomeni, da računalnik nikoli ne bo ustvaril matematično napačnega rezultata. To še ne velja za druge programe simboličnega izračuna v skupni rabi. Te druge programe, na primer, lahko dobimo enačbo a = 0 in rečeno, da jih strani delimo z a. Rezultat bo 1 = 0, saj vsebujejo pravilo a / a = 1 in pravilo 0 / a = 0.

Da bi dosegli cilj matematične korektnosti, je bilo treba v MathXpert zgraditi precej prefinjeno teoremsko preverjanje. Obstaja torej neposredna povezava med tem uporabljenim programskim projektom in mojimi raziskavami pri avtomatiziranem odbitku, ki se osredotoča na odnose med logiko in računanjem. Ta vidik projekta je v središču [30] in [34]. Ker je preverjanje v MathXpertu bolj ali manj “nevidno”, lahko uporabijo nekaj ezoteričnih tehnik, če so koristne, in odkril sem zanimivo uporabo nestandardne analize problema, ki zagotavlja, da so odbitki pravilni v povezavi z omejitvenimi težavami . Problem in njegova rešitev z uporabo nestandardne analize so podani v [36].

Več drugih oblikovalskih načel, na katerih temelji MathXpert, so razložene v [31] in [37].

 

Odvzet od : http://www.cs.sjsu.edu/faculty/beeson/Papers/mpdescr.html

Proaktivna Obfuscation

Pregled

Neodvisnost napak kopij je ključna pri uporabi replikacije v zanesljivih distribuiranih storitvah. Toda replike, ki uporabljajo isto kodo, imajo enake ranljivosti. Torej, replike ne zmorejo neodvisno, ko so pod napadom. Proaktivno obfuscation je nova metoda za obnavljanje določenega merila te neodvisnosti, pri čemer se vsaka replika občasno ponovno zažene s sveže ustvarjenim raznolikim izvršljivim.

Za obfuscation so bile predlagane različne tehnike, ki samodejno ustvarjajo različne izvedljive datoteke med zbiranjem, natovarjanjem ali v času delovanja. Te vključujejo preurejanje naslovov in skladiščenje nabora, preureditev sistemskih klicev, naključno izbiranje instrukcij in naključno razmnoževanje. Vsi proizvajajo neizprosne izvedljive izdelke, za katere se verjame, da bodo bolj verjetno, da bodo padle v odziv na določene razrede napadov in ne bodo pod nadzorom nasprotnika. Naprimer, preusmeritev preusmeritve medpomnilnika je običajno odvisna od podrobnosti o postavitvi stika, zato bodo verjetno, da se bodo kopije, ki uporabljajo različno izvedene izvršilne datoteke na podlagi preureditve naslovov ali obloge naslovov, umaknile, namesto da bi podlegle kontroli napadalca.

Model Obfuscation

Namesto da bi bili odvisni od lastnosti posameznih tehnik obfuscation, povzemamo dve lastnosti, ki jih od njih zahtevamo.

  • Nefunkcionalnost obfuscation.

Pri t> 1 je količina dela za nasprotnika, ki ogroža tanke replike, Ω (t) večja od dela, potrebnega za ogrožanje ene replike.

  • Omejen nasprotnik.

Čas, ki je potreben, da sovražnik kompromitira t + 1 replike, je večji od časa, potrebnega za ponovitev, ponovnega zagona in obnovitve n replik.

Nefunkcionalnost obfuscij pomeni, da različni izvedeni izvršilni elementi kažejo določeno mero neodvisnosti. Predpostavka sedanjih načinov zajemanja je, da približujejo neodvisnost obfuscacij. Vendar pa ima lahko dovolj časa, da bi nasprotnik še vedno lahko ogrozil t + 1 replike. Nefunkcijska osamosvojitev in omejeni nasprotnik skupaj pomenita, da je kljub temu, da redno ponovnega uvajanja in ponovnega zagona replik kljub vsemu nasprotnikom ohrani nadzor nad več kot t kompromitiranimi replikami. Zlasti do trenutka, ko bi nasprotnik lahko ogrozil t + 1 neurejene replike, so bili vsi n reobfuscated in ponovno zagnani (z napadalcem izseljen), tako da ne morejo več ogroziti replik.

Mehanizmi

Proaktivna obfuscacija je odvisna od treh mehanizmov, ki so prikazani v naslednji predstavitvi ponovljene storitve z n replikami.

  • Sinteza odgovora.

Stranke pošiljajo vnose v replike — vsaka replika izvaja isti vmesnik kot centralizirana storitev in pošlje izpis strankam. Če želite pretvoriti izhod iz več replik v izhod iz replicirane storitve, replike uporabljajo funkcijo sinteze izhodov fd, kjer d določa najmanjše število različnih replik, iz katerih je potreben odgovor. Sinteza odgovora je mehanizem, ki izvede funkcijo sinteze izhodov za stranke.

 

  • Državno okrevanje.

Replike ohranjajo stanje, ki se lahko spremeni, ko obdelujejo vnose od strank — po ponovnem zagonu mehanizem za obnovitev države zagotavlja način, kako replike lahko obnovijo stanje, tako da lahko še naprej sodelujejo pri ponovljeni storitvi. Če želite pretvoriti stanje, prejeto iz več replik v eno samo stanje, ponovljene replike uporabljajo funkcijo sinteze stanja gr, kjer r določa najmanjše število različnih replik, iz katerih je potreben odgovor.

 

  • Osveži.

Mehanizem osveževanja ponuja sveže izpraznjene izvedljive datoteke v replike, občasno znova zažene gostitelje in obvešča o replikah sprememb epohe

 

Izvajanje

Te mehanizme smo uporabili za izvajanje prototipov dveh storitev: distribuiranega požarnega zidu (na osnovi pf v OpenBSD) z uporabo replikacije državnih strojev in porazdeljene storitve za posodobitev poizvedb z uporabo kvorumskih sistemov. Oba prototipa izvajajo mehanizme v uporabniškem prostoru z uporabo pseudo-naprave za obdelavo paketov, ki jih prejme jedro. Obe izvedeni v C s pomočjo OpenSSL. V članku so podane podrobnosti o vrednotenju teh prototipov.

Koristna spletna stran: https://www.cs.cornell.edu/fbs/proactiveObuscation/proactive_obfuscation.html